Glottiphyllum depressum

(Haw.) N.E.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Aizoaceae/Glottiphyllum

At a glance

Occurrence records284

Data sources8

Biological traits12

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Glottiphyllum depressum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility284 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF284 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 18

01Narrative

Glottiphyllum depressum is a common species of succulent plant, of the family Aizoaceae, native to South Africa. It is probably the most widespread species of Glottiphyllum, after Glottiphyllum longum, and one of the most commonly found in cultivation. Though not as common as G.longum, it is far more variable in its form.Heidrun E.K. Hartmann, Horst Gölling: A monograph on the genus Glottiphyllum (Mesembryanthema, Aizoaceae). In: Bradleya 11, 1993.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max0.03 m

Seed mass0.678 mg

Life cycle & reproduction2

Life formsucculent subshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max980 m

Elevation min500 m

Epiphyteterrestrial

Other traits1

Plant support typefree-standing

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Glottiphyllum depressum has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOR392072.1 ↗557 bp

ACGT

TCGAAAACTGCCATCAGAACGACCCGTGAACACGTTTAAACACATGGGAGGGACGCATGCGGCCTCGTGCCGCCTGCCCCCCTCCCCACG …

Glottiphyllum depressum voucher Zhigila & Schmiedel 1274 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Glottiphyllum depressum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 181×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — SHARMA, A.K., & S. GHOSH. 1968. Cytotaxonomy of Ficoideae. Cytologia 33: 439-452.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type284 records

Wild obs. + sensor251

Museum / vouchered33

Range

Area of Occupancy AOO860 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 137≤1 km 27≤10 km 3>10 km 42

209 georeferenced · 42 without coordinates

Open the mapobservation + sensor251

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 32 without coordinates

Open the institutions mapphysical evidence33

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	16
Cape Town, ZA	11
MSB-3054location not on record	2
Stockholm, SE	1
Bronx, US	1
Mexico City, MX	1
South African National Biodiversity Institutelocation not on record	1

7 institutions · 33 of 33 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)