Glossostigma cleistanthum

W.R.Barker · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Phrymaceae/Glossostigma

At a glance

Occurrence records274

Data sources9

Biological traits32

DNA specimens3

eDNA detections3

Sources9 archives

Databases and archives Glossostigma cleistanthum's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility274 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources32 traits

Occurrence & distributionGBIF274 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 50

01Narrative

Glossostigma cleistanthum, also known as mudmat, is a freshwater aquatic plant native to Australia, New Zealand, India and East Africa. It is a cleistogamous plant, which is a type of self-pollinating plant that can propagate using non-opening flowers. Where growth is submerged, the leaves are between 0.5–2.5 inches long and bear closed, self-pollinating flowers. These leaves are nearly sessile and grow along the stem in alternating pairs that resemble rabbit ears. Where water recedes and growth is emergent, the leaves are much smaller, ranging between 0.2–0.5 inches in length. The emergent plants produce insect-pollinated flowers located on short stalks. It belongs to the family Phrymaceae which includes annuals and perennials.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYAusTraitsGIFT

Size & morphology8

Leaf length7 mm

Leaf length max20 mm

Leaf length min4 mm

Leaf width2 mm

Leaf width max3 mm

Leaf width min1 mm

Petiole length1.1 cm

Seed mass0.018 mg

Life cycle & reproduction10

Dispersal typeanimal

Flowering endNov

Flowering startAug

Flowering timennnnnnnyyyyn

Life formannual or helophyte

Life spanephemeral short_lived_perennial

⚠ sources differ — AusTraits: ephemeral short_lived_perennial · GIFT: perennial

Pollination syndromeinsect

Raunkiær life formtherophyte

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Leaf shapeoblanceolate oblong

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Glossostigma cleistanthum has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences10

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSDQ371425.1 ↗612 bpUSA · 2005

ACGT

AACAAATATAGGGTAATGGCGATGGGTTACATCCCACTTGCTGTTGTCCTTTTTCCCCACGACTAGTGCACTTGTTGTACCTTTCGTGTG …

Glossostigma cleistanthum isolate MercerLk_05-1031 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Glossostigma cleistanthum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 50 n = 25

Ploidypolyploid inferred

Chromosome records50–502n range50median50mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 502×CCDB · new-zealand · CCDB · ipcn-api-dl

CCDB · new-zealand

CCDB · ipcn-api-dl — de Lange, P. J., B. G. Murray & P. M. Datson. 2004. Contributions to a chromosome atlas of the New Zealand flora---38. Counts for 50 families. New Zealand J. Bot. 42: 873–904.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type274 records

Wild obs. + sensor83

Museum / vouchered162

Other29

Origin

Native9

Range

Area of Occupancy AOO624 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 18≤1 km 11≤10 km 6>10 km 3

38 georeferenced · 45 without coordinates

Open the mapobservation + sensor83

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤100 m 25≤1 km 31≤10 km 69>10 km 7

132 georeferenced · 30 without coordinates

Open the institutions mapphysical evidence162

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	21
Philadelphia, US	15
Brisbane, AU	14
Adelaide, AU	12
Christchurch, NZ	8
Bronx, US	6
Auckland, NZ	6
Canberra, AU	5
Mount Annan, AU	4
University of Stellenboschlocation not on record	2
Whitewater, US	2
Dover, US	2
Kensington, AU	1
Kew, GB	1
John T. Waterhouse Herbariumlocation not on record	1
Chongqing Museumlocation not on record	1
Armidale, AU	1

17 institutions · 102 of 162 vouchered records shown · 60 without an institution code

09Environmental DNA3 detections

Where the DNA of Glossostigma cleistanthum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)