Glossocarya hemiderma

(F.Muell. ex Benth.) Benth. ex B.D.Jacks. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Lamiaceae/Glossocarya

At a glance

Occurrence records629

Data sources6

Biological traits25

DNA specimens9

eDNA detections4

Sources6 archives

Databases and archives Glossocarya hemiderma's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility629 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources25 traits

Occurrence & distributionGBIF629 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI9 specimens

01Narrative

Glossocarya hemiderma là một loài thực vật có hoa trong họ Hoa môi. Loài này được Benth. ex B.D.Jacks. mô tả khoa học đầu tiên năm 1893.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology9

Fruit length8 mm

Fruit width3 mm

Leaf length75 mm

Leaf width47.5 mm

Petiole length0.65 cm

Plant height4.5 m

Seed length6.5 mm

Seed mass1.64 mg

Seed width1.5 mm

Life cycle & reproduction6

Deciduousnessevergreen

Flowering timeyyyyyynnnnnn

Life formclimbing shrub or liana

Life spanperennial

Raunkiær life formphanerophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Climatewet tropical

Climberobligatory

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typemericarp

Growth formshrub

⚠ sources differ — GIFT: shrub · AusTraits: climber_woody shrub · TRY: Climber

Leaf compoundnesssimple

Leaf shapecordate ovate

Woodinesswoody

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Glossocarya hemiderma has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes4

GenBank sequences4

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKM895963.1 ↗535 bpAustralia

ACGT

GGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCA …

Glossocarya hemiderma voucher 1076420359 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★rbcLatrnH-psbA

plant barcodemarker

08Occurrence & distribution

Record type629 records

Wild obs. + sensor37

Museum / vouchered294

Cultivated / captive1

Other297

Origin

Native19

Range

Area of Occupancy AOO1 720 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 11≤1 km 1≤10 km 1

13 georeferenced · 24 without coordinates

Open the mapobservation + sensor37

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy54% within 1 km

≤100 m 106≤1 km 23≤10 km 68>10 km 43

240 georeferenced · 54 without coordinates

Open the institutions mapphysical evidence294

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	148
Smithfield, AU	65
Museo Entomologico de Leonlocation not on record	36
Mount Annan, AU	18
Canberra, AU	8
Palmerston, AU	4
Kew, GB	3
Cambridge, US	3
Australian Tropical Herbariumlocation not on record	2
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
James Cook Townsvillelocation not on record	1
Honolulu, US	1
University of Stellenboschlocation not on record	1
Armidale, AU	1

14 institutions · 292 of 294 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Glossocarya hemiderma was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.6 °C 20.3–25.0

Seasonal swing summer↔winter8.90 °C

Max temp (day)26.5 °C 25.5–27.9

Min temp (night)17.6 °C 15.0–23.3

Precipitation109 mm/mo 33.0–377

Air humidity61.0 % 47.9–68.1

Moisture balance116 mm/mo

Vapour deficit1,083 Pa 885–1,497

Wind speed3.10 m/s

Cloud cover33.9 % 20.8–51.8

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)