Gloeochaete wittrockiana

Lagerh. · species

image placeholder — illustration coming later

Plantae/Glaucophyta/Glaucophyceae/Glaucocystales/Glaucocystaceae/Gloeochaete

At a glance

Occurrence records132

Data sources5

Biological traits1

DNA specimens2

eDNA detections26

Sources5 archives

Databases and archives Gloeochaete wittrockiana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility132 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI26 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF132 records

Environmental DNA2 datasets · 8 countries26 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Gloeochaete wittrockiana est une espèce d'algues de la famille des Glaucocystaceae, de l'embranchement des Glaucophyta. Gloeochaete wittrockiana est l'espèce type du genre Gloeochaete.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment1

Habitat freshwateryes

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gloeochaete wittrockiana has left across the world's sequence archives.

At a glance

DNA specimens2

BINs1

Marker genes3

GenBank sequences4

eDNA detections26

The DNA barcodea real sequence read deposited for this species

ITSLC120715.1 ↗1 098 bp

ACGT

AATTCTGCTGGTCTGCCAGTATACACAACCGTGAACCTCCCGTTGGGGCGAGTTTCTGACTCAGCTGTGGACGTGGATGGCCTCTTTGTC …

Gloeochaete wittrockiana genes for ITS1, 5.8S rRNA, ITS2, LSU rRNA, complete and partial sequence, strain: SAG 46.84

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★rbcL2★ITS2

animal barcodeplant barcodefungal barcode

08Occurrence & distribution

Record type132 records

Wild obs. + sensor15

Museum / vouchered117

Range

Area of Occupancy AOO260 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 11≤1 km 1≤10 km 1

13 georeferenced · 2 without coordinates

Open the mapobservation + sensor15

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 117 records without

Open the institutions mapphysical evidence117

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
ARMS-MBONlocation not on record	20

1 institutions · 20 of 117 vouchered records shown · 97 without an institution code

09Environmental DNA26 detections

Where the DNA of Gloeochaete wittrockiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found26

Studies independent surveys2

Countries8

Verifiable raw sequence linked20

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 26 detections have coordinates

Open the map8 countries0

Marina; semi-industrial; 9.5 - Subtidal Sand…Marine Protected Area; protected; 9.2 - Subt…Marina; semi-industrial; 9.2 - Subtidal Rock…Research site; semi-industrial; 9.5 - Subtid…Marina/Harbour; semi-industrial; 9.6 - Subti…Marine Protected Area; protected; 9.5 - Subt…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

pH5.88 3.90–6.18

Conductivity10,210 µS/cm 4,200–26,000

Organic carbon2.43 %

Phosphorus10.0 mg/kg

Clay17.5 %

Sand78.6 %

Depth0 m

SoilVertosolKandosol

6 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.2 °C 11.0–24.1

Seasonal swing summer↔winter15.6 °C

Max temp (day)18.0 °C 13.1–30.4

Min temp (night)14.5 °C 7.60–20.9

Precipitation62.1 mm/mo 6.00–93.5

Air humidity59.5 % 46.1–64.2

Moisture balance-60.7 mm/mo -127–-13.0

Vapour deficit662 Pa 542–1,580

Wind speed3.30 m/s 2.90–5.60

Cloud cover38.3 % 20.9–63.3

CHELSA 1981–2010, ~9 km grid, at location & month of 26 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)