Gleditsia triacanthos
speciesAt a glance
Occurrence records134 152
Data sources16
Biological traits139
DNA specimens26
eDNA detections20
Sources16 archives
Databases and archives Gleditsia triacanthos's data was compiled from.
WikipediaWikimedia Foundation14 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility134 152 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics26 specimens↗
NCBIUS National Library of Medicinesequences↗
dukesphytochemcompounds
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements6 literature sources139 traits
Chemical compositionDukesPhytochem · LOTUS · NPASS152 compounds
Occurrence & distributionGBIF134 152 records
Environmental DNA1 datasets · 5 countries20 detections
DNA & barcodingBOLD · NCBI26 specimens
Genome at a glanceCCDB2n = 28
01Narrative
The honey locust (Gleditsia triacanthos), also known as the thorny locust or thorny honeylocust, is a deciduous tree in the family Fabaceae, native to central North America where it is mostly found in the moist soil of river valleys. Honey locust is highly adaptable to different environments, has been introduced worldwide, and is an aggressive, invasive species.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDAUSDATRYWCVP
Size & morphology22
Fruit length275 mm
Fruit length max450 mm
Fruit length min200 mm
Fruit width32.5 mm
Fruit width max50 mm
Fruit width min25 mm
Inflorescence length max12 cm
Inflorescence length min10 cm
Leaf length35 mm
Leaf length max200 mm
Leaf length min20 mm
Leaf width8.5 mm
Leaf width max12 mm
Leaf width min5 mm
Petiole length4 cm
Plant height27.16 m
⚠ sources differ — GIFT: 27.16 m · AusTraits: 17.5 m · LEDA: 30 m · USDA: 21.34 m · TRY: 40 m
Plant height max40 m
Plant height min3 m
Seed length8.57 mm
⚠ sources differ — TRY: 8.57 mm · AusTraits: 10 mm
Seed mass174 mg
⚠ sources differ — TRY: 174 mg · LEDA: 185 mg · GIFT: 176 mg
Seed mass max224 mg
Seed mass min19.7 mg
Life cycle & reproduction32
Bloom periodLate Spring
Coppice potentialYes
Deciduousnessdeciduous
Dispersal typeanimal
Flower colourgreen
Flower conspicuousNo
Flower length max3 mm
Flower length min2.5 mm
Flowering endApr
Flowering startJun
Flowering timennnnnnnnyyyn
Fruit seed period beginSpring
Fruit seed period endFall
Growth rate USDAModerate
Life formshrub or tree
Life spanperennial
⚠ sources differ — TRY: perennial · AusTraits: perennial · LEDA: poly-annuals 5-50 years (medium-lived perennials) · GIFT: perennial
Lifespan categoryModerate
Lifespan years122 years
Propagated by bare rootYes
Propagated by bulbNo
Propagated by containerYes
Propagated by cormNo
Propagated by cuttingsYes
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formphanerophyte
Resprout abilityYes
Seed spread rateSlow
Seedling vigorMedium
Vegetative spread rateNone
Diet & foraging1
Parasiteindependent
Habitat & environment32
Active growth periodSpring and Summer
Adapted to coarse textured soilsNo
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max1 500 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerDense
Foliage porosity winterModerate
Foliage textureFine
Fruit colourbrown
Fruit typelegume_indehiscent
⚠ sources differ — AusTraits: legume_indehiscent · GIFT: pod
Growth formtree
Growth form USDASingle Crown
Habitat GIFTLowland
Hedge toleranceLow
Known allelopathNo
Leaf compoundnesscompound
Leaf formparipinnate
Leaf retentionNo
Leaf shapeelliptical ovate
Low growing grassNo
Mycorrhiza typearbuscular
Root depth min34 in
Shape and orientationErect
Small grainNo
Woodinesswoody
⚠ sources differ — TRY: woody · AusTraits: woody · LEDA: non-woody · GIFT: woody
Physiology & chemistry26
Anaerobic toleranceLow
C:N ratioHigh
Caco3 toleranceLow
Cold stratification requiredNo
Drought toleranceHigh
Fertility requirementLow
Fire resistantNo
Fire toleranceMedium
Frost free days min150 days
Leaf C:N ratio18.74 g/g
Leaf c529 mg/g
Leaf dry-matter content (LDMC)386 mg/g
Leaf n28.45 mg/g
Moisture useLow
Nitrogen fixation levelNone
Nitrogen fixingnitrogen_fixer
Photosynthetic pathwayC3
Precipitation max70 in
Precipitation min20 in
Protein potentialLow
Salinity toleranceMedium
Shade toleranceHigh
Soil pH max8 pH
Soil pH min4.9 pH
Temperature min-33 °F
Wood density720 mg/cm³
Uses & economy16
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Fuelwood productHigh
Lumber productYes
Naval store productNo
Nursery stock productNo
Palatable browse animalMedium
Palatable graze animalLow
Palatable humanNo
Post productYes
Pulpwood productNo
Seeds per pound2 800 per lb
ToxicityNone
Veneer productNo
Other traits10
Defenseyes
Diaspore typegerminule
Fall conspicuousYes
Fruit seed abundanceHigh
Fruit seed conspicuousYes
Fruit seed persistenceYes
Height at 20yr10.67 m
Inflorescenceraceme
Planting density max700 per acre
Planting density min139 per acre
03Chemical composition152 compounds
Compounds documented for Gleditsia triacanthos across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cooking🌿 Fruit
Compound class profile5 classes
Cembrane diterpenoids46
Unsaturated fatty acids7
Branched fatty acids $ Unsaturated fatty acids5
Simple phenolic acids5
Cholestane steroids $ Ergostane steroids4
Documented compounds152 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| CARBOHYDRATES | 969,000 ppm | DukesPhytochem | |
| PROTEIN | 231,000 ppm | DukesPhytochem | |
| FIBER | 211,000 ppm | DukesPhytochem | |
| ASH | 54,000 ppm | DukesPhytochem | |
| FAT | 46,000 ppm | DukesPhytochem | |
| GLUCOSE | 44,400 ppm | DukesPhytochem |
05DNA & barcoding26 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gleditsia triacanthos has left across the world's sequence archives.
At a glance
DNA specimens26
Marker genes6
GenBank sequences10
eDNA detections20
Countries5
The DNA barcodea real sequence read deposited for this species
CCCCTCCCCACTACCCTCGAGGCTGCGATTCGCCGGGGTGGATGATGGCCTCCCGTGGGGACGAAAGACGAGCCTATAGCGTGGACCACC …
Gleditsia triacanthos voucher SW84WEP internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK3★rbcL6★rbcLa★ITS1★ITS2
animal barcodeplant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Gleditsia triacanthos carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 28 n = 14
Ploidydiploid inferred
Chromosome records28–282n range28median28mode12records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2812×CCDB · slov-fl · CCDB · iber-fl · CCDB · poland +7
CCDB · slov-fl — Májovský J. et al., 1974a: Index of chromosome numbers of Slovakian flora (Part 3). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 22: 1-20.
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. IV. Leguminosae Fernandes, A. & M. F. Santos.Bol. Soc. Brot. ser. 245: 177-225(1971).
CCDB · iber-fl — Cytotaxonomy of spanish plants. IV.-Dicotyledons: Caesalpinacea-Asteracea. Lve, A. & E. Kjellqvist.Lagascalia4(2): 153-211(1974).
CCDB · poland — Pogan E., Jankun A., Wcis?o H. et al. 1988. Further studies in chromosome numbers of Polish Angiosperms. Part XXI. Acta Biol. Cracov. Ser. Bot. 30, 119-136.
CCDB · ipcn-api-dl — Pogan, E., A. Jankun & H. Wcis|1lo. 1989. Further studies in chromosome numbers of Polish angiosperms. Part XXI. Acta Biol. Cracov., Ser. Bot. 30: 119–136.
CCDB · book-ipcn67-71 — FERNANDES, A., & M.F. SANTOS. 1971. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal IV. Leguminosae. Bol. Soc. Brot. 45 (ser. 2): 177-226.
CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian flora. (Part 3). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 22: 1-20.
CCDB · book-indian_vol1 — Atchison, E. 1947a ; Berger, C.A. et al. 1958; Gordon, D. 1970 ; Fernan- des, A. & Santos, M.F. 1971
CCDB · eflora
CCDB · book-atlas-flowering-plants
CCDB · kew — Ohri D, Kumar A. 1986. Nuclear DNA amounts in some tropical hardwoods. Caryologia 39: 303-307.
n 141×CCDB · book-ipcn67-71
CCDB · book-ipcn67-71 — GORDON, D. 1970. In IOPB chromosome number report XXX. Taxon 19: 918-919:-
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
07Deep time~4.3 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin4.3 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
How it livedPBDB
Dietphotoautotroph
08Occurrence & distribution
Record type134 152 records
Wild obs. + sensor122 392
Museum / vouchered3 024
Cultivated / captive8 633
Other103
Origin
Native55
Introduced366
Range
Area of Occupancy AOO84 328 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy88% within 1 km
≤100 m 21 902≤1 km 3 073≤10 km 2 634>10 km 929
28 538 georeferenced · 93 854 without coordinates
Open the mapobservation + sensor122 392
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy51% within 1 km
≤100 m 315≤1 km 645≤10 km 782>10 km 135
1 877 georeferenced · 1 147 without coordinates
Open the institutions mapphysical evidence3 024
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy75% within 1 km
≤100 m 9≤10 km 3
12 georeferenced · 8 621 without coordinates
Open the mapnot free-living8 633
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions166 of 253 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Wuzhou, CN | 256 |
| Philadelphia, US | 157 |
| Bloomington, US | 117 |
| Bronx, US | 85 |
| Madison, US | 82 |
| Chongqing Museumlocation not on record | 80 |
| Fort Worth, US | 66 |
| Allentown, US | 63 |
| BIO-UNIPIlocation not on record | 62 |
| Saint Louis, US | 54 |
| Moscow State Universitylocation not on record | 52 |
| Brisbane, AU | 49 |
| Emporia, US | 46 |
| Jena Microbial Resource Collectionlocation not on record | 43 |
| Bangkok, TH | 42 |
| Chapel Hill, US | 40 |
| Macomb, US | 38 |
| Toronto, CA | 37 |
| University of Stellenboschlocation not on record | 36 |
| Austin, US | 33 |
| Williamsburg, US | 31 |
| Mount Annan, AU | 31 |
| Denver, US | 27 |
| LDlocation not on record | 26 |
| Millersville, US | 26 |
| Denton, US | 26 |
| Pittsburg, US | 24 |
| Fayetteville, US | 24 |
| Spearfish, US | 23 |
| College Park, US | 22 |
| Canberra, AU | 22 |
| BDBClocation not on record | 21 |
| Auckland, NZ | 21 |
| Jackson, US | 20 |
| MeiseBGlocation not on record | 20 |
| Flagstaff, US | 20 |
| Ann Arbor, US | 19 |
| Barcelona, ES | 19 |
| Mississippi State, US | 18 |
| University of New Hampshirelocation not on record | 17 |
| Chadron, US | 17 |
| Tuscaloosa, US | 15 |
| GAlocation not on record | 15 |
| WTUlocation not on record | 15 |
| US | 14 |
| Lord Fairfax Community Collegelocation not on record | 14 |
| Montréal, CA | 14 |
| College of the Atlantic, Museumlocation not on record | 14 |
| Dekalb, US | 13 |
| BAYLUlocation not on record | 13 |
| Pretoria, ZA | 13 |
| Mount Pleasant, US | 12 |
| GB | 12 |
| Minia, EG | 11 |
| Museo Entomologico de Leonlocation not on record | 11 |
| St. Paul, US | 11 |
| Columbia, US | 10 |
| Cape Town, ZA | 10 |
| Burlington, US | 10 |
| Knoxville, US | 10 |
| Vitoria, ES | 9 |
| Durban, ZA | 9 |
| Riverside, US | 9 |
| New Haven, US | 9 |
| Albuquerque, US | 9 |
| Philadelphia, US | 9 |
| Davenport, US | 8 |
| Waverly, US | 8 |
| Canadian Department of Agriculturelocation not on record | 8 |
| Acadia Universitylocation not on record | 8 |
| Springfield, US | 8 |
| ASUlocation not on record | 8 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 8 |
| Staten Island, US | 8 |
| CICYTEXlocation not on record | 8 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 8 |
| BRNUlocation not on record | 8 |
| Fredericksburg, US | 8 |
| Mexico City, MX | 7 |
| Rotorua, NZ | 7 |
| MAlocation not on record | 7 |
| Córdoba, AR | 7 |
| Lubbock, US | 7 |
| McWane Science Centerlocation not on record | 7 |
| Little Rock, US | 7 |
| Edmonton, CA | 7 |
| Lincoln, US | 7 |
| Urumqi, CN | 7 |
| Valdosta State Universitylocation not on record | 6 |
| DOI/NPS, Greenbelt Parklocation not on record | 6 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 6 |
| Morgantown, US | 6 |
| Adam Mickiewicz University in Poznańlocation not on record | 6 |
| Adelaide, AU | 6 |
| Texas Lutheran Universitylocation not on record | 6 |
| Miami, US | 6 |
| CJBGlocation not on record | 6 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 6 |
| Clemson, US | 6 |
| EL PASO, US | 6 |
| Christchurch, NZ | 6 |
| Wlocation not on record | 6 |
| US | 6 |
| Chicago, US | 6 |
| Chicago, US | 6 |
| Hudson, US | 5 |
| Davis, US | 5 |
| Logan, US | 5 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 5 |
| Kirksville, US | 5 |
| Washington, US | 5 |
| Tempe, US | 5 |
| China Agricultural Universitylocation not on record | 5 |
| Fairfax, US | 5 |
| Provincia di Livornolocation not on record | 5 |
| Tall Timbers Research Stationlocation not on record | 5 |
| Brookings, US | 5 |
| Salzburg, AT | 5 |
| Tampa, US | 4 |
| Kew, GB | 4 |
| Moscow, US | 4 |
| Jefferson City, US | 4 |
| Museum of the Rockieslocation not on record | 4 |
| New Brunswick, US | 4 |
| Government College University Lahore, Dr. Sultan Ahmad Herbariumlocation not on record | 4 |
| DOI/NPS, Selma to Montgomery National Historic Traillocation not on record | 4 |
| Badajoz, ES | 4 |
| SLU Artdatabankenlocation not on record | 4 |
| Pullman, US | 4 |
| Kensington, AU | 4 |
| Mohonk Preservelocation not on record | 4 |
| Entomological Society of Latvialocation not on record | 4 |
| Cincinnati, US | 3 |
| Claremont, US | 3 |
| Green Bay, US | 3 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 3 |
| Bern, CH | 3 |
| Dover, US | 3 |
| University of Guelph, OAC Herbariumlocation not on record | 3 |
| Santa Barbara, US | 3 |
| Madrid, ES | 3 |
| AUAlocation not on record | 3 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 3 |
| Whitewater, US | 3 |
| Karlsruhe, DE | 3 |
| University of Southern Mississippilocation not on record | 3 |
| San Luis Obispo, US | 3 |
| Norfolk, US | 3 |
| Jaén, ES | 3 |
| Paris, FR | 3 |
| Vancouver, CA | 3 |
| PRClocation not on record | 3 |
| Oskarshamn, SE | 3 |
| Meguro Parasitological Museumlocation not on record | 2 |
| València, ES | 2 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 2 |
| Armidale, AU | 2 |
| South African National Biodiversity Institute, Compton Herbariumlocation not on record | 2 |
| Stephenville, US | 2 |
| Québec, CA | 2 |
| Conway, US | 2 |
| Hamilton, US | 2 |
| Beijing, CN | 2 |
| Salamanca, ES | 2 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 2 |
| Richmond, US | 2 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 2 |
| Conway, US | 2 |
| PUC-RSlocation not on record | 2 |
| Phoenix, US | 2 |
| Boise, US | 2 |
| GZUlocation not on record | 2 |
| Provo, US | 2 |
| University of Tennessee at Chattanoogalocation not on record | 2 |
| Kingston, US | 2 |
| Sede di Via Giorgio La Pira del Museo di Storia naturale di Firenze | Via Giorgio La Pira headquarter of the Natural History Museum in Florencelocation not on record | 2 |
| Beijing, CN | 2 |
| Turlock, US | 2 |
| GJOlocation not on record | 2 |
| San Diego, US | 2 |
| Uniwersytet Warszawskilocation not on record | 2 |
| Portland, US | 1 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 1 |
| Pamplona, ES | 1 |
| Granada, ES | 1 |
| Durham, US | 1 |
| Corvallis, US | 1 |
| Banyoles, ES | 1 |
| Audubon Society -- Silver Bluff Audubon Center and Sanctuarylocation not on record | 1 |
| Instituto de Investigação Científica Tropicallocation not on record | 1 |
| Institut de Biologia Evolutiva, (CSIC-UPF)location not on record | 1 |
| Cambridge, US | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| Durham, US | 1 |
| Pocatello, US | 1 |
| Stellenbosch University, DST- NRF Centre of Excellence for Invasion Biologylocation not on record | 1 |
| Alexandria Universitylocation not on record | 1 |
| Coimbra, PT | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
| LNBG$location not on record | 1 |
| Museo Achille Folettolocation not on record | 1 |
| Guasave, MX | 1 |
| Parkville, AU | 1 |
| Chicago, US | 1 |
| CASlocation not on record | 1 |
| Tartu, EE | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Grand Junction, US | 1 |
| IPE-CSIClocation not on record | 1 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 1 |
| Göteborg, SE | 1 |
| Keene State Universitylocation not on record | 1 |
| University of Hamburglocation not on record | 1 |
| Smithfield, AU | 1 |
| Long Beach, US | 1 |
| Durango, MX | 1 |
| West Virginia Wesleyan Collegelocation not on record | 1 |
| BFLlocation not on record | 1 |
| Dresden, DE | 1 |
| UMKClocation not on record | 1 |
| Zürich, CH | 1 |
| San Angelo, US | 1 |
| Johnson City, US | 1 |
| Uniwersytet Wrocławskilocation not on record | 1 |
| Hermosillo, MX | 1 |
| Nishihara, JP | 1 |
| University of Johannesburglocation not on record | 1 |
| H-Kummerlocation not on record | 1 |
| Porrentruy, CH | 1 |
| Northridge, US | 1 |
| Saint John, CA | 1 |
| Tilburg, NL | 1 |
| University of North Carolina at Pembrokelocation not on record | 1 |
| Chengdu, CN | 1 |
| UChlocation not on record | 1 |
| Valparaiso, CL | 1 |
| Henderson, US | 1 |
| USFSlocation not on record | 1 |
| Berlin, DE | 1 |
| Chapingo, MX | 1 |
| Cheney, US | 1 |
| Whitehorse, CA | 1 |
| Caldwell, US | 1 |
| UIBlocation not on record | 1 |
| Université Lavallocation not on record | 1 |
| La Paz, MX | 1 |
| San Sebastián, ES | 1 |
| Harrisonburg, US | 1 |
| Irvine, US | 1 |
| Córdoba, ES | 1 |
| Durango, US | 1 |
| LINUlocation not on record | 1 |
| Ivano-Frankove, UA | 1 |
253 institutions · 2 783 of 3 024 vouchered records shown · 239 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA20 detections
Where the DNA of Gleditsia triacanthos was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found20
Studies independent surveys1
Countries5
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 20 detections have coordinates
Open the map5 countries0
Coastal Sage Scrub along roadside., Sandy so…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median18.2 °C 15.7–20.8
Seasonal swing summer↔winter21.2 °C
Max temp (day)25.6 °C 20.7–26.5
Min temp (night)12.2 °C 10.6–18.0
Precipitation32.4 mm/mo 9.00–89.8
Air humidity52.7 % 50.3–59.9
Moisture balance-66.4 mm/mo -127–-21.1
Vapour deficit1,007 Pa 719–1,159
Wind speed3.30 m/s 2.00–4.20
Cloud cover26.4 % 15.6–38.7
CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.