Gleditsia aquatica

Marshall · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Gleditsia

At a glance

Occurrence records732

Data sources12

Biological traits87

DNA specimens2

eDNA detections2

Sources12 archives

Databases and archives Gleditsia aquatica's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility732 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources87 traits

Chemical compositionNPASS3 compounds

Occurrence & distributionGBIF732 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 28

01Narrative

Gleditsia aquatica, commonly called water locust or swamp locust after its habitat of river swamps and slough margins, is a tree native to the Southeastern United States and adjacent regions.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTUSDATRY

Size & morphology2

Plant height13.62 m

⚠ sources differ — GIFT: 13.62 m · USDA: 12.19 m · TRY: 17.14 m

Seed mass151 mg

Life cycle & reproduction24

Bloom periodMid Summer

Coppice potentialNo

Deciduousnessdeciduous

Flower colourgreen

Flower conspicuousNo

Fruit seed period beginFall

Fruit seed period endWinter

Growth rate USDAModerate

Life formtree

Life spanperennial

Lifespan categoryLong

Propagated by bare rootNo

Propagated by bulbNo

Propagated by containerNo

Propagated by cormNo

Propagated by cuttingsNo

Propagated by seedYes

Propagated by sodNo

Propagated by sprigsNo

Propagated by tubersNo

Resprout abilityNo

Seed spread rateSlow

Seedling vigorMedium

Vegetative spread rateSlow

Habitat & environment21

Active growth periodSpring

Adapted to coarse textured soilsYes

Adapted to fine textured soilsYes

Adapted to medium textured soilsYes

BloatNone

Climatetemperate

Climberself-supporting

Foliage colorGreen

Foliage porosity summerModerate

Foliage porosity winterPorous

Foliage textureFine

Fruit colourbrown

Growth formtree

⚠ sources differ — GIFT: tree · TRY: Tree, Shrub

Growth form USDASingle Stem

Known allelopathNo

Leaf retentionNo

Low growing grassNo

Root depth min36 in

Shape and orientationErect

Small grainNo

Woodinesswoody

Physiology & chemistry18

Anaerobic toleranceLow

C:N ratioMedium

Caco3 toleranceLow

Cold stratification requiredNo

Drought toleranceNone

Fire resistantNo

Fire toleranceLow

Frost free days min207 days

Nitrogen fixation levelLow

Photosynthetic pathwayC3

Precipitation max68 in

Precipitation min16 in

Protein potentialHigh

Salinity toleranceNone

Shade toleranceMedium

Soil pH max8 pH

Soil pH min6 pH

Temperature min27 °F

Uses & economy15

Berry nut seed productNo

Christmas tree productNo

Fodder productNo

Fuelwood productLow

Lumber productYes

Naval store productNo

Nursery stock productYes

Palatable browse animalMedium

Palatable graze animalMedium

Palatable humanNo

Post productYes

Pulpwood productNo

Seeds per pound3 000 per lb

ToxicitySlight

Veneer productYes

Other traits7

Fall conspicuousNo

Fruit seed abundanceLow

Fruit seed conspicuousNo

Fruit seed persistenceNo

Height at 20yr18.29 m

Planting density max640 per acre

Planting density min320 per acre

03Chemical composition3 compounds

Compounds documented for Gleditsia aquatica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Flavonols1

Documented compounds3 total

Tissue Source Quantified only

Compound	Amount	Source
MGQCJMAMKIFKOH-FECRCKMQSA-N	present	NPASS
MGQCJMAMKIFKOH-VNKDJVKDSA-N	present	NPASS
Robinetin	present	NPASS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gleditsia aquatica has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences10

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSAF509999.1 ↗695 bp

ACGT

TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATGCCTATCAAAAAGGACGACCCGCGAACCGGTGAGACCCTCGGGCGGGCGGAGG …

Gleditsia aquatica clone 1 26S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 18S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★ITS7

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Gleditsia aquatica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 281×CCDB · book-atlas-flowering-plants

CCDB · book-atlas-flowering-plants

n 141×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — GORDON, D. 1970. In IOPB chromosome number report XXX. Taxon 19: 918-919:-

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type732 records

Wild obs. + sensor443

Museum / vouchered284

Cultivated / captive5

Origin

Introduced8

Range

Area of Occupancy AOO1 684 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 241≤1 km 68≤10 km 15>10 km 37

361 georeferenced · 82 without coordinates

Open the mapobservation + sensor443

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy46% within 1 km

≤100 m 17≤1 km 23≤10 km 29>10 km 18

87 georeferenced · 197 without coordinates

Open the institutions mapphysical evidence284

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy80% within 1 km

≤1 km 4≤10 km 1

5 georeferenced

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions34 of 51 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Jena Microbial Resource Collectionlocation not on record	60
Tampa, US	31
Bronx, US	18
Saint Louis, US	14
Miami, US	10
Tall Timbers Research Stationlocation not on record	9
Jackson, US	9
Little Rock, US	8
Columbia, US	8
Wuzhou, CN	8
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	7
Chapel Hill, US	7
Fayetteville, US	6
Bangkok, TH	6
University of Stellenboschlocation not on record	5
GAlocation not on record	5
LDlocation not on record	4
Valdosta State Universitylocation not on record	4
Mississippi State, US	4
Russellville, US	4
University of Southern Mississippilocation not on record	4
Bloomington, US	4
Burlington, US	3
Chongqing Museumlocation not on record	3
Clemson, US	3
Edmonton, CA	3
Fort Worth, US	2
Canadian Department of Agriculturelocation not on record	2
US	2
MeiseBGlocation not on record	2
Austin, US	2
Berlin, DE	1
Tuscaloosa, US	1
Riverside, US	1
San Angelo, US	1
Provo, US	1
University of North Carolina at Pembrokelocation not on record	1
Wlocation not on record	1
Montréal, CA	1
Lincoln, US	1
Conway, US	1
New Brunswick, US	1
Christchurch, NZ	1
Flagstaff, US	1
MEXUlocation not on record	1
DOI/NPS, Mississippi National River & Recreation Arealocation not on record	1
Stockholm, SE	1
Oskarshamn, SE	1
BAYLUlocation not on record	1
Waverly, US	1
DOI/NPS, Greenbelt Parklocation not on record	1

51 institutions · 277 of 284 vouchered records shown · 7 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Gleditsia aquatica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)