Glechoma hederacea
speciesAt a glance
Occurrence records1 165 731
Data sources15
Biological traits50
DNA specimens81
eDNA detections44
Sources15 archives
Databases and archives Glechoma hederacea's data was compiled from.
WikipediaWikimedia Foundation13 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility1 165 731 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI44 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics81 specimens↗
NCBIUS National Library of Medicinesequences↗
dukesphytochemcompounds
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources50 traits
Chemical compositionDukesPhytochem · LOTUS · NPASS144 compounds
Occurrence & distributionGBIF1 165 731 records
Environmental DNA1 datasets · 11 countries44 detections
DNA & barcodingBOLD · NCBI81 specimens
Genome at a glanceCCDB · GoaT · NCBI1 Gbp
01Narrative
Flower's appearance in visible, UVA, and NIR spectrums. The UV nectar guides may help attract bees. Glechoma hederacea is an aromatic, perennial, evergreen creeper of the mint family Lamiaceae. It is commonly known as ground-ivy, gill-over-the-ground, creeping charlie, alehoof, tunhoof, catsfoot, field balm, and run-away-robin. It is also sometimes known as creeping jenny, but that name more commonly refers to Lysimachia nummularia. It is used as a salad green in many countries. European settlers carried it around the world, and it has become a well-established introduced and naturalized plant in a wide variety of localities. It is also considered an aggressive invasive weed of woodlands and lawns in some parts of North America. In the absence of any biological control, research conducted by the USDA herbicides are relied upon (despite their drawbacks) particularly for woodland ecosystems. The plant's extensive root system makes it difficult to eradicate by hand-pulling.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVPAusTraits
Size & morphology13
Leaf mass20.96 mg
Leaf size808 mm²
⚠ sources differ — TRY: 808 mm² · LEDA: 882 mm² · GIFT: 882 mm²
Plant height0.288 m
⚠ sources differ — GIFT: 0.288 m · LEDA: 0.2 m · TRY: 0.075 m
Plant height generative0.2 m
Plant height max0.6 m
Plant height min0.1 m
Seed length1.61 mm
Seed mass0.639 mg
⚠ sources differ — TRY: 0.639 mg · LEDA: 0.685 mg · GIFT: 0.679 mg
Seed mass max0.69 mg
Seed mass min0.69 mg
Seed volume0.61 mm³
Seed volume max0.61 mm³
Seed volume min0.61 mm³
Life cycle & reproduction13
Deciduousnessevergreen
Dispersal typehuman
⚠ sources differ — LEDA: agochor · GIFT: zoochorous
Flowering endJun
Flowering startApr
Life formperennial or subshrub
Life spanperennial
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Seed number50
Self fertilizationabsent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment11
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max700 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Growth formherb
Habitat GIFTforest, inhabited places, meadows, rivers, shrubberies
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry9
Leaf C:N ratio20.82 g/g
Leaf c416 mg/g
Leaf dry-matter content (LDMC)179 mg/g
⚠ sources differ — TRY: 179 mg/g · LEDA: 160 mg/g
Leaf n28.35 mg/g
Leaf p3.4 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)25.97 mm²/mg
⚠ sources differ — TRY: 25.97 mm²/mg · LEDA: 34.45 mm²/mg · GIFT: 34.72 mm²/mg
Wood density120 mg/cm³
Other traits2
Diaspore typegenerative dispersule
Seeds per fruit101-1000
03Chemical composition144 compounds
Compounds documented for Glechoma hederacea across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
💊 Medicinal use documented
Compound class profile5 classes
Cinnamic acids and derivatives20
Flavones4
Germacrane sesquiterpenoids3
Simple phenolic acids2
Phenylethanoids1
Documented compounds144 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| TANNIN | 70,000 ppm | DukesPhytochem | |
| POTASSIUM | 46,000 ppm | DukesPhytochem | |
| ROSMARINIC-ACID | 25,000 ppm | DukesPhytochem | |
| CALCIUM | 23,000 ppm | DukesPhytochem | |
| CHLORINE | 11,000 ppm | DukesPhytochem | |
| PHOSPHORUS | 3,500 ppm | DukesPhytochem | |
| SULFUR | 3,400 ppm | DukesPhytochem | |
| EO | 600 ppm | DukesPhytochem | |
| 2-BETA-HYDROXYURSOLIC-ACID | 600 ppm | DukesPhytochem |
05DNA & barcoding81 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Glechoma hederacea has left across the world's sequence archives.
At a glance
DNA specimens81
Marker genes9
GenBank sequences10
eDNA detections44
Countries13
The DNA barcodea real sequence read deposited for this species
ACGAAGCGTCCGCCCCCCGCACCCCGTCCGCGGTGCGTGCGGGGGATCGGCCGTCTATCAAAATGTCATAACGACTCTCGGCAACGGATA …
Glechoma hederacea voucher KS23 HER0522 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL4★rbcLa★ITS4★ITS1★ITS2atpF-atpHrpoC1trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Glechoma hederacea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 017 120 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Glechoma hederacea1.02 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 36 n = 18
Ploidy4× tetraploid · measured
Chromosome records18–362n range36median36mode63records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3646×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl +11
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J., Murín A., Feráková V., Hindáková M., Schwarzová T., Uhríková A., Váchová M. & Záborský J., 1987: Karyotaxonomický prehľad flóry Slovenska. Veda, Bratislava.
CCDB · slov-fl — Májovský J. et al., 1974b: Index of chromosome numbers of Slovakian flora Part 4. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 23: 1-23.
CCDB · slov-fl — Mártonfiová L., 2007: [New records in Armeria, Arum, Campanula, Chenopodium, Corispermum, Duchesnea, Erythronium, Fritillaria, Glechoma, Hedera, Leucojum, Onobrychis, Ranunculus, Sorbus, Symphyotrichum, Tussilago, and Viola], pp. 109, 113, 150, 190, 201, 234, 251, 271, 294, 299, 368, 414, 493, 557, 565, 596, 622, 623. - In: Marhold K., Mártonfi P., Mereďa P. jun., Mráz P. (eds), Chromosome number survey of the ferns and flowering plants of Slovakia. Veda, Bratislava.
CCDB · slov-fl — Feráková V., Kochjarová J., Králik E., Schwarzová T. & Záborský J., 1997: Cievnaté rastliny, pp. 86-156. - In: Feráková V. & Kocianová E. (eds), Flóra, geológia a paleontológia Devínskej Kobyly. Litera, Bratislava.
CCDB · brit-fl — Morton, J.K. Watsonia 9: 239-246 (1973)
CCDB · brit-fl — Bailey, J.P., Gornall, R.J. Irish Naturalists' J. : ()
CCDB · brit-fl — Hollingsworth, P.M., Gornall, R.J., Bailey, J.P. Watsonia 19: 134-137 (1992)
CCDB · brit-fl — Rutland, J.P. New Phytol. 40: 210-214 (1941)
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 764-768. Morales, R.Lagascalia17(2): 388-391(1994).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3500
CCDB · poland — Skali?ska M., Czapik R., Piotrowicz M. et al. 1959. Further studies in chromosome numbers of Polish Angiosperms (Dicotyledons). Acta Soc. Bot. Pol. 28, 487-529.
CCDB · poland — ?ukowski W. and S?owi?ska T. 1979. Chromosome numbers of Angiosperms of North-Western Poland. Part 1. Fragm. Flor. Geobot. 25, 477-483.
CCDB · ipcn-api-dl — Gill, B. S., S. S. Bir & V. K. Singhal. 1981. Cytomorphological studies in north Indian pomegranate (Punica granatum Linn.). J. Cytol. Genet. 16: 35–45.
CCDB · ipcn-api-dl — Sokolovskaya, A. P., N. S. Probatova & E. G. Rudyka. 1986. A contribution to the study of chromosome numbers and geographical distribution of some species of the family Lamiaceae in the Soviet far east. Bot. Zhurn. SSSR 71: 195–200.
CCDB · ipcn-api-dl — Hill, L. M. 1989. IOPB chromosome data 1. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 13: 17–19.
CCDB · ipcn-api-dl — Hollingsworth, P. M., R. J. Gornall & J. P. Bailey. 1992. Contribution to a cytological catalogue of the British and Irish flora, 2. Watsonia 19: 134–137.
CCDB · ipcn-api-dl — Mĕsíček, J. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Zukowski, W. & T. Slowinska. 1979. Chromosome numbers of angiosperms of Northwestern Poland. Fragm. Florist. Geobot. 25: 477–483.
CCDB · ipcn-api-dl — Hruaovská-Osuská, L. 1988. Karyological study of some taxa of the flora of the northern part of Povăzsk@3y Inovec. Part I. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 35: 69–79.
CCDB · book-ipcn73-74 — MORTON, J.K. 1973. A cytological study of the British Labiatae excluding Mentha) (Lamiaceae). Watsonia 9: 239-246.
CCDB · book-ipcn73-74 — DERSCH, G. 1974. Ueber einige Chromosomenzahlungen an mitteleuropaischen Blutenpflanzen. II. Philippia 2: 75-82.
CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian Flora. (Part 4). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 23: 1-23.
CCDB · book-fedorov — Rutland 1941
CCDB · book-fedorov — Felfoldy 1947a
CCDB · book-fedorov — Palya 1949
CCDB · book-fedorov — Hara H. 1954
CCDB · book-fedorov — Mulligan 1961
CCDB · book-fedorov — Gadella, Kliphuis 1963
CCDB · book-fedorov — Taylor S. H. 1949
CCDB · book-atlas-flowering-plants — Felfoldy 1947.
CCDB · book-atlas-flowering-plants — Rutland 1941
CCDB · Cave1959 — Skalinska et al. 1959
CCDB · Cave1963 — Gadella & Klip, 1963
CCDB · CromoCat 2015 — Den Brand, C., van, van Meel, F. C. M. & Wieffering, J. H. (1979). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXIV]. Taxon 28(4): 395-397.
CCDB · CromoCat 2015 — Hill, L. M. (1989). IOPB Chromosome Data 1 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 13: 17-19.
CCDB · CromoCat 2015 — Hollingsworth, P. M., Gornall, R. J. & Bailey, J. P. (1992). Contribution to a cytological catalogue of the British and Irish flora, 2. Watsonia 19: 134-137.
CCDB · CromoCat 2015 — Hrušovská-Osuská, L'. (1988). Karyological study of some taxa of the flora of the northern part of Povazsky Inovec. Part I. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 35: 69-79.
+5 more references
2n 1814×CCDB · slov-fl · CCDB · fl-europaea · CCDB · ipcn-api-dl +4
CCDB · slov-fl — Májovský J., Murín A., Feráková V., Hindáková M., Schwarzová T., Uhríková A., Váchová M. & Záborský J., 1987: Karyotaxonomický prehľad flóry Slovenska. Veda, Bratislava.
CCDB · slov-fl — Sedláková B., 2007: [New record in Glechoma], pp. 294. - In: Marhold K., Mártonfi P., Mereďa P. jun., Mráz P. (eds), Chromosome number survey of the ferns and flowering plants of Slovakia. Veda, Bratislava.
CCDB · slov-fl — Feráková V., Kochjarová J., Králik E., Schwarzová T. & Záborský J., 1997: Cievnaté rastliny, pp. 86-156. - In: Feráková V. & Kocianová E. (eds), Flóra, geológia a paleontológia Devínskej Kobyly. Litera, Bratislava.
CCDB · fl-europaea — Sorsa, 1963
CCDB · ipcn-api-dl — Kartashova, N. N., L. A. MALAKHOVA, Koslova & N. A. Dubrova. 1974. Chisla chromosom u rjada polesnykh rastenij is prirodnykh populjacij flory Priob'ja. Biol. Biofis. Tomsk. 47–53.
CCDB · book-fedorov — Scheerer (Love A., LOve D. 1942b)
CCDB · book-fedorov — Suzuka 1950a
CCDB · book-fedorov — L. 1961)
CCDB · book-fedorov — Sorsa V. 1963b
CCDB · book-fedorov — Sugiura 1938, 1940a
CCDB · book-fedorov — Sugiura 1940a
CCDB · book-atlas-flowering-plants — Scheerer, L. & L. '42
CCDB · Cave1963 — Sorsa 1963c
CCDB · CromoCat 2015 — Kartashova, N. N., Malakhova, L. A., Koslova, A. A. & Dubrova, N. A. (1974b). Chisla chromosom u rjada polesnykh rastenij is prirodnykh populjacij flory Priob'ja. Biol. Biofis. Tomsk 47-53.
2n 243×CCDB · poland · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants
CCDB · poland — ?ukowski W. and S?owi?ska T. 1979. Chromosome numbers of Angiosperms of North-Western Poland. Part 1. Fragm. Flor. Geobot. 25, 477-483.
CCDB · book-fedorov — LOve A., Love D. 1942b iberi
CCDB · book-atlas-flowering-plants — L. & L. 1942a
n 183×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Mulligan, G. A. 1984. Chromosome numbers of some plants native and naturalized in Canada. Naturaliste Canad. 111: 447–449.
CCDB · CromoCat 2015 — Gill, B. S., Bir, S. S. & Singhal, V. K. (1981b). Cytomorphological studies in north Indian pomegranate (Punica granatum L.). Journal of Cytology and Genetics 16: 35-45.
CCDB · CromoCat 2015 — Mulligan, G. A. (1984). Chromosome numbers of some plants native and naturalized in Canada. Naturaliste Canad. 111: 447-449.
n 92×CCDB · book-ipcn73-74 · CCDB · CromoCat 2015
CCDB · book-ipcn73-74 — LAANE, M.M. 1971. Chromosome number in Norwegian vascular plant species: 6. (in Norwegian). Blyttia 29: 229-234.
CCDB · CromoCat 2015 — Gill, B. S., Bir, S. S. & Singhal, V. K. (1981b). Cytomorphological studies in north Indian pomegranate (Punica granatum L.). Journal of Cytology and Genetics 16: 35-45.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
tetraploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · family-scale
PloiDB · family-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness98.4% BUSCO
07Deep time~0.25 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin0.25 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type1 165 731 records
Wild obs. + sensor1 143 547
Museum / vouchered18 758
Cultivated / captive473
Fossil2
Other2 951
Origin
Native38 928
Introduced65
Range
Area of Occupancy AOO951 928 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy53% within 1 km
≤100 m 316 952≤1 km 159 554≤10 km 413 180>10 km 9 391
899 077 georeferenced · 244 470 without coordinates
Open the mapobservation + sensor1 143 547
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy37% within 1 km
≤100 m 1 301≤1 km 3 531≤10 km 7 980>10 km 425
13 237 georeferenced · 5 521 without coordinates
Open the institutions mapphysical evidence18 758
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy6% within 1 km
≤100 m 1≤10 km 2>10 km 15
18 georeferenced · 455 without coordinates
Open the mapnot free-living473
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions216 of 363 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 8 078 |
| BFLlocation not on record | 563 |
| Moscow State Universitylocation not on record | 493 |
| LDlocation not on record | 487 |
| Chongqing Museumlocation not on record | 440 |
| Olocation not on record | 352 |
| Salzburg, AT | 281 |
| BIO-UNIPIlocation not on record | 223 |
| Oskarshamn, SE | 209 |
| MeiseBGlocation not on record | 196 |
| Oulu, FI | 182 |
| KMNlocation not on record | 180 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 168 |
| Bergen, NO | 161 |
| Uniwersytet Warszawskilocation not on record | 158 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 143 |
| Turku, FI | 143 |
| Adam Mickiewicz University in Poznańlocation not on record | 141 |
| Görlitz, DE | 130 |
| Trondheim, NO | 122 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 114 |
| St. Paul, US | 111 |
| Bloomington, US | 111 |
| Green Bay, US | 111 |
| Wuzhou, CN | 104 |
| SLU Artdatabankenlocation not on record | 102 |
| Québec, CA | 97 |
| College Park, US | 97 |
| Provincia di Livornolocation not on record | 87 |
| Jyväskylä, FI | 81 |
| Karlsruhe, DE | 72 |
| University of New Hampshirelocation not on record | 72 |
| Burlington, US | 70 |
| Bronx, US | 67 |
| Ann Arbor, US | 66 |
| Acadia Universitylocation not on record | 59 |
| Uniwersytet Śląski w Katowicachlocation not on record | 58 |
| Tartu, EE | 55 |
| Saint Louis, US | 55 |
| TROMlocation not on record | 55 |
| Millersville, US | 49 |
| South Kensington, GB | 49 |
| TUR-Alocation not on record | 49 |
| New Haven, US | 47 |
| BRNUlocation not on record | 46 |
| Williamsburg, US | 45 |
| Kuopio, FI | 45 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 45 |
| Uppsala, SE | 44 |
| Pullman, US | 43 |
| Tallinn, EE | 41 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 40 |
| GZUlocation not on record | 39 |
| MAlocation not on record | 37 |
| Madison, US | 37 |
| Université Lavallocation not on record | 37 |
| WTUlocation not on record | 36 |
| Helsinki, FI | 35 |
| Montréal, CA | 34 |
| Saint John, CA | 34 |
| University of Stellenboschlocation not on record | 33 |
| UGentlocation not on record | 32 |
| Bern, CH | 31 |
| Whitewater, US | 30 |
| GJOlocation not on record | 28 |
| Entomological Society of Latvialocation not on record | 27 |
| Philadelphia, US | 27 |
| Vitoria, ES | 27 |
| Corvallis, US | 26 |
| Natural History Museum Rotterdamlocation not on record | 25 |
| Norfolk, US | 25 |
| Zhengzhou, CN | 23 |
| Mlocation not on record | 23 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 22 |
| Columbia, US | 21 |
| Vancouver, CA | 21 |
| Tula State Universitylocation not on record | 20 |
| Wlocation not on record | 20 |
| Barcelona, ES | 20 |
| McWane Science Centerlocation not on record | 19 |
| Berlin, DE | 19 |
| Dresden, DE | 19 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 19 |
| Uniwersytet Opolskilocation not on record | 17 |
| Stockholm, SE | 17 |
| Bangkok, TH | 17 |
| Allentown, US | 16 |
| Salamanca, ES | 16 |
| Porvoo, FI | 16 |
| Toronto, CA | 16 |
| Chadron, US | 15 |
| BDBClocation not on record | 14 |
| Portland, US | 14 |
| Christchurch, NZ | 14 |
| Bozeman, US | 14 |
| Montréal, CA | 14 |
| Moscow, US | 14 |
| València, ES | 13 |
| Hudson, US | 13 |
| Porrentruy, CH | 13 |
| Lord Fairfax Community Collegelocation not on record | 13 |
| Frankfurt am Main | 13 |
| Emporia, US | 13 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 12 |
| Auckland, NZ | 12 |
| Knoxville, US | 12 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 12 |
| Jackson, US | 12 |
| Durham, US | 12 |
| FJIDClocation not on record | 12 |
| Pittsburg, US | 12 |
| IWEP FEB RASlocation not on record | 11 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 11 |
| Beijing, CN | 11 |
| Chicago, US | 10 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 10 |
| Fayetteville, US | 10 |
| CJBGlocation not on record | 10 |
| Zürich, CH | 9 |
| Staten Island, US | 9 |
| Guangzhou, CN | 9 |
| BClocation not on record | 9 |
| Tuscaloosa, US | 9 |
| Flagstaff, US | 8 |
| Chapel Hill, US | 8 |
| PrivatHerblocation not on record | 8 |
| University of Southern Mississippilocation not on record | 8 |
| Chicago, US | 8 |
| Dekalb, US | 8 |
| ZRC-SAZUlocation not on record | 7 |
| Urumqi, CN | 7 |
| DBF-NHMDlocation not on record | 7 |
| nbflocation not on record | 7 |
| UniKSlocation not on record | 7 |
| Wuhan, CN | 7 |
| Mount Annan, AU | 7 |
| Museum of the Rockieslocation not on record | 7 |
| Tilburg, NL | 7 |
| WNNUlocation not on record | 7 |
| Keene State Universitylocation not on record | 7 |
| Canadian Department of Agriculturelocation not on record | 6 |
| Kirksville, US | 6 |
| Missoula, US | 6 |
| Tacoma, US | 6 |
| Taipei, TW | 6 |
| Washington, US | 6 |
| Forssa, FI | 6 |
| New Brunswick, US | 6 |
| Dover, US | 6 |
| Madrid, ES | 6 |
| Kew, GB | 6 |
| Arcata, US | 6 |
| Riverside, US | 6 |
| Wellington, NZ | 6 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 5 |
| Canberra, AU | 5 |
| San Angelo, US | 5 |
| Macomb, US | 5 |
| SZUlocation not on record | 5 |
| Boise, US | 5 |
| WINlocation not on record | 5 |
| Jena Microbial Resource Collectionlocation not on record | 5 |
| Granada, ES | 5 |
| China Agricultural Universitylocation not on record | 5 |
| Minia, EG | 5 |
| Davenport, US | 5 |
| Bourges, FR | 5 |
| Rovaniemi, FI | 5 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 5 |
| Waverly, US | 5 |
| Denver, US | 5 |
| Fulda, DE | 5 |
| Spearfish, US | 4 |
| University of Birminghamlocation not on record | 4 |
| Winterthur, CH | 4 |
| GB | 4 |
| University of Tennessee at Chattanoogalocation not on record | 4 |
| Springfield, US | 4 |
| Morgantown, US | 4 |
| Victoria, CA | 4 |
| Smithsonian Institutionlocation not on record | 4 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 4 |
| Hangzhou, CN | 4 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 4 |
| Museo Achille Folettolocation not on record | 4 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 4 |
| Rotorua, NZ | 4 |
| Taipei, TW | 4 |
| Naturalis Biodiversity Centerlocation not on record | 4 |
| Xinjiang Institute of Ecology and Geography, Chinese Academy of Scienceslocation not on record | 4 |
| Philadelphia, US | 4 |
| Urumqi, CN | 4 |
| Tromso University Museumlocation not on record | 4 |
| Fairfax, US | 4 |
| Uniwersytet w Białymstokulocation not on record | 4 |
| Zürich, CH | 4 |
| Servico de Microbiologia e Imunologialocation not on record | 4 |
| Whitehorse, CA | 4 |
| UoB-IBlocation not on record | 4 |
| Castelar, AR | 4 |
| Inner Mongolia Universitylocation not on record | 4 |
| CICYTEXlocation not on record | 4 |
| Northridge, US | 4 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 4 |
| Jaén, ES | 4 |
| Claremont, US | 4 |
| ASUlocation not on record | 4 |
| OLAlocation not on record | 4 |
| University of Alberta Museumslocation not on record | 4 |
| GAlocation not on record | 4 |
| Davis, US | 4 |
| Puerto Ayora, EC | 4 |
| Pamplona, ES | 4 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 3 |
| Wuhan, CN | 3 |
| Institute of the biological problems of the North FEB RASlocation not on record | 3 |
| Pocatello, US | 3 |
| Istituto Agrario Castelnuovolocation not on record | 3 |
| BGBMlocation not on record | 3 |
| Adelaide, AU | 3 |
| US | 3 |
| Johnson City, US | 3 |
| Glarus, CH | 3 |
| Frauenfeld, CH | 3 |
| Xining, CN | 3 |
| Pamplona, ES | 3 |
| Guiyang, CN | 3 |
| National Museum Waleslocation not on record | 3 |
| Hobart, AU | 3 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 3 |
| Finnish Museum of Natural Historylocation not on record | 3 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 3 |
| University of Guelph, OAC Herbariumlocation not on record | 3 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 3 |
| Paris, FR | 3 |
| Xiamen, CN | 3 |
| Trois-Rivières, CA | 3 |
| Fredericksburg, US | 3 |
| JP | 3 |
| Odawara, JP | 2 |
| Ivano-Frankove, UA | 2 |
| Otaru, JP | 2 |
| DOI/NPS, Selma to Montgomery National Historic Traillocation not on record | 2 |
| Mohonk Preservelocation not on record | 2 |
| Nijmegen, NL | 2 |
| Mississippi State, US | 2 |
| San Luis Obispo, US | 2 |
| Bend, US | 2 |
| Hamilton, US | 2 |
| UFOPlocation not on record | 2 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 2 |
| Namur, BE | 2 |
| Muséum Henri Lecoqlocation not on record | 2 |
| CJBNlocation not on record | 2 |
| Kandalaksha State Nature Reservelocation not on record | 2 |
| Córdoba, AR | 2 |
| BSBIlocation not on record | 2 |
| Guiyang, CN | 2 |
| Richmond, US | 2 |
| Cambridge, US | 2 |
| Gijón, ES | 2 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 2 |
| Fort Worth, US | 2 |
| Guilin, CN | 2 |
| Phoenix, US | 2 |
| Brisbane, AU | 2 |
| Armidale, AU | 2 |
| Kunming, CN | 2 |
| Asheville, US | 2 |
| Little Rock, US | 2 |
| Alicante, ES | 2 |
| Samara National Research Universitylocation not on record | 2 |
| Salvador, BR | 2 |
| Long Beach, US | 2 |
| Ypsilanti, US | 2 |
| West Virginia Wesleyan Collegelocation not on record | 2 |
| Oswego, US | 2 |
| FLADlocation not on record | 2 |
| Mount Pleasant, US | 2 |
| Edmonton, CA | 2 |
| Jurica-Suchy Nature Museumlocation not on record | 2 |
| Museo Entomologico de Leonlocation not on record | 2 |
| Clemson, US | 2 |
| Laboratorio de Ictiologialocation not on record | 2 |
| Chicago, US | 2 |
| Santa Barbara, US | 2 |
| “Manash Kozybayev North Kazakhstan University" NPLClocation not on record | 1 |
| Durham, US | 1 |
| Science Museum of Minnesotalocation not on record | 1 |
| Yugra State University Biological Collectionlocation not on record | 1 |
| DULlocation not on record | 1 |
| Sion, CH | 1 |
| USFS/BHSClocation not on record | 1 |
| Göteborg, SE | 1 |
| Logan, US | 1 |
| Grand Junction, US | 1 |
| Kagoshima, JP | 1 |
| Edinburgh, GB | 1 |
| BioFokuslocation not on record | 1 |
| Baltimore, US | 1 |
| ULBF-AGRlocation not on record | 1 |
| Boumlocation not on record | 1 |
| Turlock, US | 1 |
| Podgorica, ME | 1 |
| UNIVASFlocation not on record | 1 |
| TAIElocation not on record | 1 |
| KR | 1 |
| Decorah, US | 1 |
| Nagatoro-machi, Chichibu-gun, JP | 1 |
| Brussel, BE | 1 |
| Caldwell, US | 1 |
| Tempe, US | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| NMBU:MINAlocation not on record | 1 |
| Jefferson City, US | 1 |
| University of Genevalocation not on record | 1 |
| Awka, NG | 1 |
| LINUlocation not on record | 1 |
| Shanghai, CN | 1 |
| IPE-CSIClocation not on record | 1 |
| Xian, CN | 1 |
| Jiangxi College of Traditional Chinese Medicinelocation not on record | 1 |
| San Isidro, AR | 1 |
| AUAlocation not on record | 1 |
| Firenze, IT | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| Los Angeles, US | 1 |
| Lincoln, US | 1 |
| ENTClocation not on record | 1 |
| IDElocation not on record | 1 |
| San Diego, US | 1 |
| SWlocation not on record | 1 |
| AUT001location not on record | 1 |
| Mount Berry, US | 1 |
| San Francisco, US | 1 |
| PRClocation not on record | 1 |
| Orem, US | 1 |
| Nagano City, JP | 1 |
| San Jose, US | 1 |
| Sevilla, ES | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Badajoz, ES | 1 |
| Tennessee Technological Universitylocation not on record | 1 |
| Nanjing, CN | 1 |
| College of the Atlantic, Museumlocation not on record | 1 |
| Taipei, TW | 1 |
| University of New Englandlocation not on record | 1 |
| Banyoles, ES | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Portland, US | 1 |
| Royal Botanical Gardenslocation not on record | 1 |
| Kingston, US | 1 |
| Monastir, TN | 1 |
| National Botanic Garden of Waleslocation not on record | 1 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 1 |
| NTNU University Museum, Department of Natural Historylocation not on record | 1 |
| Fargo, US | 1 |
| Tall Timbers Research Stationlocation not on record | 1 |
| Pacific Lutheran Universitylocation not on record | 1 |
| Walla Walla, US | 1 |
| Miami, US | 1 |
| John May Museum of Natural Historylocation not on record | 1 |
363 institutions · 17 101 of 18 758 vouchered records shown · 1 149 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA44 detections
Where the DNA of Glechoma hederacea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found44
Studies independent surveys1
Countries11
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 44 detections have coordinates
Open the map11 countries0
Woodland
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median12.2 °C 7.00–17.6
Seasonal swing summer↔winter22.3 °C
Max temp (day)15.4 °C 9.80–21.5
Min temp (night)8.40 °C 3.10–13.9
Precipitation83.5 mm/mo 50.4–111
Air humidity60.5 % 55.8–63.9
Moisture balance-17.7 mm/mo -54.1–71.5
Vapour deficit564 Pa 422–838
Wind speed3.50 m/s 2.60–5.50
Cloud cover45.1 % 39.1–58.6
CHELSA 1981–2010, ~9 km grid, at location & month of 33 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.