Glaucium corniculatum
(L.) Rudolph · speciesAt a glance
Occurrence records7 021
Data sources10
Biological traits53
DNA specimens1
eDNA detections0
Sources10 archives
Databases and archives Glaucium corniculatum's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility7 021 records↗
BOLD SystemsCentre for Biodiversity Genomics1 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotypeOn this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources53 traits
Chemical compositionLOTUS30 compounds
Occurrence & distributionGBIF7 021 records
DNA & barcodingBOLD · NCBI1 specimens
Genome at a glanceCCDB · GoaT587 Mbp
01Narrative
Glaucium corniculatum, la Glaucienne écarlate, Glaucienne en cornet ou Glaucière rouge, est une espèce de plantes à fleurs de la famille des Papaveraceae.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology18
Fruit length210 mm
⚠ sources differ — AusTraits: 210 mm · GIFT: 120 mm
Fruit length max200 mm
Fruit length min100 mm
Fruit width3 mm
Leaf length180 mm
Leaf length max250 mm
Leaf length min100 mm
Leaf width45 mm
Leaf width max30 mm
Leaf width min15 mm
Plant height0.325 m
⚠ sources differ — GIFT: 0.325 m · AusTraits: 0.75 m · LEDA: 0.325 m · TRY: 0.406 m
Plant height generative0.325 m
Plant height max1 m
Plant height min0.1 m
Seed length1.35 mm
Seed mass0.94 mg
⚠ sources differ — TRY: 0.94 mg · GIFT: 0.876 mg
Seed mass max1.02 mg
Seed mass min0.58 mg
Life cycle & reproduction15
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dispersal typeself
Flower colourblack
Flower length max40 mm
Flower length min30 mm
Flowering endJul
Flowering startApr
Life formannual or perennial
Life spanannual
⚠ sources differ — TRY: annual · AusTraits: annual biennial · LEDA: summer annuals · GIFT: annual
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Seed number166
Self fertilizationabsent
Diet & foraging1
Parasiteindependent
Habitat & environment13
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max1 000 m
Elevation min0 m
Epiphyteterrestrial
Fruit typecapsule
Growth formherb
Habitat GIFTcrop fields, mountains, old fields, roadsides, stony places
Leaf compoundnesssimple
Leaf formpinnatifid
Leaf shapeovate
Woodinessnon-woody
Physiology & chemistry4
Leaf dry-matter content (LDMC)265 mg/g
Photosynthetic pathwayC3
Seed longevity index1
Specific leaf area (SLA)14.61 mm²/mg
Other traits2
Diaspore typeseed
Shoot orientationascending
03Chemical composition30 compounds
Compounds documented for Glaucium corniculatum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Aporphine alkaloids $ Isoquinoline alkaloids16
Isoquinoline alkaloids5
Aporphine alkaloids4
Isoquinoline alkaloids $ Protopine alkaloids2
Isoquinoline alkaloids $ Tetrahydroisoquinoline alkaloids1
Documented compounds30 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Dicentrine | present | LOTUS | |
| (+)-Glaucine | present | LOTUS | |
| (6aR)-2,10,11-trimethoxy-6-methyl-6-oxido-5,6,6a,7-tetrahydro-4H-dibenzo[de,g]quinolin-6-ium-1-ol | present | LOTUS | |
| (6As)-2,9,10-trimethoxy-6-methyl-5,6,6a,7-tetrahydro-4H-dibenzo[de,g]quinolin-1-ol | present | LOTUS | |
| (R)-3-Hydroxyl-2,9,10-Trimethoxytetrahyrdooxyprotoberberine | present | LOTUS | |
| (S)-Corydine | present | LOTUS | |
| (S)-Isocorydine | present | LOTUS | |
| 16-Hydroxy-4,5,15-trimethoxy-10-methyl-10-azoniatetracyclo[7.7.1.02,7.013,17]heptadeca-1(17),2,4,6,9,11,13,15-octaen-8-one | present | LOTUS | |
| 3,4,15-Trimethoxy-10-methyl-10-azatetracyclo[7.7.1.02,7.013,17]heptadeca-1,3,5,7,9(17),13,15-heptaen-16-ol | present | LOTUS | |
| 4H-Dibenzo(de,g)quinoline-1,4-diol, 5,6,6a,7-tetrahydro-2,10,11-trimethoxy-6-methyl-, (4R,6aS)- | present | LOTUS |
05DNA & barcoding1 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Glaucium corniculatum has left across the world's sequence archives.
At a glance
DNA specimens1
Marker genes1
GenBank sequences1
Countries1
The DNA barcodea real sequence read deposited for this species
CAAACAGAGACTAAAGCAAGTGTTGGATTCAAAGCGGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAAACCAAAGAT …
Glaucium corniculatum voucher EDNA15-0042727 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★rbcL1
plant barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Glaucium corniculatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size586 800 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Glaucium corniculatum0.59 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 12 n = 6
Ploidy2× diploid · measured
Chromosome records12–142n range12median12mode22records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1221×GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl · CCDB · iber-fl +7
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J. et al., 1974b: Index of chromosome numbers of Slovakian flora Part 4. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 23: 1-23.
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. XVII. Papaveraceae Queirs, M.Bol. Soc. Brot. ser. 254: 153-171(1980).
CCDB · ipcn-api-dl — Queiros, M. 1980. Contribuisáo para o conhecimento citotaxonomico das spermatophyta de Portugal XVII Papaveraceae. Bol. Soc. Brot. 54: 153–171.
CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Amin, A. 1979. Chromosome numbers of ten flowering plants of Egypt. United Arab Rep. J. 21: 211–212.
CCDB · book-ipcn75-78 — Murin 1974
CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian Flora. (Part 4). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 23: 1-23.
CCDB · book-fedorov — Sugiura 1936a, b, 1937a
CCDB · book-atlas-flowering-plants — Sugiura 1936b
CCDB · kew — Bennett MD, Smith JB. 1976. Nuclear DNA amounts in angiosperms. Philosophical Transactions of the Royal Society of London Series B-Biological Sciences 274: 227-274.
CCDB · CromoCat 2015 — Amin, A. (1979). Chromosome numbers of ten flowering plants of Egypt. United Arab Rep. J. 21: 211-212.
CCDB · CromoCat 2015 — Hindakova, M. (1974). Index of chromosome numbers of Slovakian flora. (Part 4). Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 23: 1-23.
CCDB · CromoCat 2015 — Javurková-Jarolímová, V. (1992). List of Chromosome Numbers of the Czech Vascular Plants. In J. Mesíccek & V. Javurková-Jarolímová. Academia, Praha Praha
CCDB · CromoCat 2015 — M?sí?ek J. et Jarolímová-Jav?rková V. (1992). List of chromosome numbers of the Czech vascular plants. Academia, Praha. p. 1-144.
CCDB · CromoCat 2015 — Queirós, M. (1990). Notas cariológicas em algumas Ranunculaceae portuguesas. Collect. Bot. (Barcelona) 18: 45-57.
CCDB · CromoCat 2015 — Sugiura, T. (1936a). Studies on the chromosome numbers in higher plants, with special reference to cytokinesis. I. Cytologia 7: 544-595.
CCDB · CromoCat 2015 — Sugiura, T. (1936b). A list of chromosome numbers in Angiospermous plants. II. Proc. Imp. Acad. Tokyo 12(5): 144-146.
CCDB · CromoCat 2015 — Sugiura, T. (1937b). Studies on the chromosome numbers in higher plants, with special reference to cytokinesis. II. Cytologia Fujii Jub.(2): 845-849.
CCDB · CromoCat 2015 — Sugiura, T. (1940c). Chromosome studies on Papaveraceae with special reference to the phylogeny. Cytologia 10: 558-576.
CCDB · CromoCat 2015 — Queirós, M. (1980b). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. XVII. Papaveraceae. Bol. Soc. Brot. 54: 153-171.
2n 141×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Oberprieler, C. & R. Vogt. (1994). Reports (294-312). Fl. Medit. 4: 262-269.
n 67×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · iber-fl — Nmeros cromosomticos de plantas occidentales, 608-618. Ruz de Clavijo Jimnez, E.Anales Jard. Bot. Madrid47(2): 425-430(1990).
CCDB · ipcn-api-dl — Ruíz de Clavijo, E. 1990. Números cromosomáticos de plantas occidentales, 608--618. Anales Jard. Bot. Madrid 47: 425–430.
CCDB · ipcn-api-dl — Amin, A. 1979. Chromosome numbers of ten flowering plants of Egypt. United Arab Rep. J. 21: 211–212.
CCDB · CromoCat 2015 — Amin, A. (1979). Chromosome numbers of ten flowering plants of Egypt. United Arab Rep. J. 21: 211-212.
CCDB · CromoCat 2015 — Ruíz de Clavijo Jiménez, E. (1990b). Números cromosomáticos de plantas occidentales, 608-618. Anales Jard. Bot. Madrid 47(2): 425-430.
CCDB · CromoCat 2015 — Vent, W. & B. Mory. (1973). Beiträge zur kenntnis der sippenstruktur der gattungen Glaucium Adans. und Dicranostigma Hooker f. et Thomson (Papaveraceae). Gleditschia 1: 33-41.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type7 021 records
Wild obs. + sensor5 679
Museum / vouchered1 290
Cultivated / captive4
Other48
Origin
Native361
Introduced63
Range
Area of Occupancy AOO14 416 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy60% within 1 km
≤100 m 1 114≤1 km 1 417≤10 km 1 515>10 km 189
4 235 georeferenced · 1 444 without coordinates
Open the mapobservation + sensor5 679
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy41% within 1 km
≤100 m 85≤1 km 219≤10 km 313>10 km 116
733 georeferenced · 557 without coordinates
Open the institutions mapphysical evidence1 290
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy50% within 1 km
≤100 m 1≤10 km 1
2 georeferenced · 2 without coordinates
Open the mapnot free-living4
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions63 of 100 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Moscow State Universitylocation not on record | 166 |
| Helsinki, FI | 102 |
| Adelaide, AU | 89 |
| MAlocation not on record | 68 |
| LDlocation not on record | 42 |
| BClocation not on record | 37 |
| BRNUlocation not on record | 31 |
| Berlin, DE | 30 |
| Barcelona, ES | 29 |
| BDBClocation not on record | 29 |
| Granada, ES | 28 |
| Wlocation not on record | 20 |
| Turku, FI | 20 |
| Oskarshamn, SE | 19 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 17 |
| CICYTEXlocation not on record | 17 |
| Salamanca, ES | 16 |
| Museo Entomologico de Leonlocation not on record | 15 |
| Wuzhou, CN | 15 |
| Mount Annan, AU | 14 |
| Alicante, ES | 14 |
| Sevilla, ES | 14 |
| Badajoz, ES | 13 |
| College of the Atlantic, Museumlocation not on record | 13 |
| Oulu, FI | 13 |
| Vitoria, ES | 13 |
| MeiseBGlocation not on record | 12 |
| Bern, CH | 11 |
| Austin, US | 11 |
| Canberra, AU | 10 |
| Córdoba, ES | 9 |
| Phyletisches Museum Jenalocation not on record | 8 |
| PRClocation not on record | 8 |
| South Kensington, GB | 8 |
| EEZA-CSIClocation not on record | 7 |
| Jaén, ES | 7 |
| Entomological Society of Latvialocation not on record | 6 |
| Fort Worth, US | 6 |
| BFLlocation not on record | 5 |
| Pamplona, ES | 5 |
| Bronx, US | 5 |
| Provincia di Livornolocation not on record | 4 |
| Brisbane, AU | 4 |
| Kensington, AU | 4 |
| Saint Louis, US | 4 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 4 |
| UIBlocation not on record | 4 |
| Tampere, FI | 4 |
| Madrid, ES | 4 |
| Frankfurt am Main | 3 |
| Görlitz, DE | 3 |
| Palmerston, AU | 3 |
| Bozeman, US | 3 |
| Pretoria, ZA | 3 |
| Mlocation not on record | 3 |
| Rishon Le Zion, IL | 3 |
| Christchurch, NZ | 3 |
| Denver, US | 3 |
| Tartu, EE | 3 |
| RJBJCIlocation not on record | 2 |
| Edinburgh, GB | 2 |
| Brussel, BE | 2 |
| Uniwersytet Warszawskilocation not on record | 2 |
| Tilburg, NL | 2 |
| Pamplona, ES | 2 |
| Córdoba, AR | 2 |
| BSBIlocation not on record | 2 |
| Pullman, US | 2 |
| Uniwersytet Jagiellońskilocation not on record | 1 |
| Santa Barbara, US | 1 |
| Hobart, AU | 1 |
| John T. Waterhouse Herbariumlocation not on record | 1 |
| Dresden, DE | 1 |
| NMBU:MINAlocation not on record | 1 |
| Saint John, CA | 1 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 1 |
| Forssa, FI | 1 |
| Armidale, AU | 1 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 1 |
| JBSlocation not on record | 1 |
| Wellington, NZ | 1 |
| Uppsala, SE | 1 |
| Claremont, US | 1 |
| Cape Town, ZA | 1 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 1 |
| Philadelphia, US | 1 |
| Salzburg, AT | 1 |
| SLU Artdatabankenlocation not on record | 1 |
| Institute for Biology of National Academy of Sci.location not on record | 1 |
| Adam Mickiewicz University in Poznańlocation not on record | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| JBCLMlocation not on record | 1 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 1 |
| Northridge, US | 1 |
| College Park, US | 1 |
| Missoula, US | 1 |
| Brookings, US | 1 |
| EL PASO, US | 1 |
| Flagstaff, US | 1 |
| Jyväskylä, FI | 1 |
100 institutions · 1 114 of 1 290 vouchered records shown · 176 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.