Gladiolus tristis

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Gladiolus

At a glance

Occurrence records767

Data sources9

Biological traits21

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Gladiolus tristis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility767 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources21 traits

Occurrence & distributionGBIF767 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 30

01Narrative

گلایول همیشهبهار(نام علمی: Gladiolus tristis) نام یک گونه از سرده گلایول است.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology6

Leaf length450 mm

Leaf width3 mm

Plant height0.45 m

Plant height max1.5 m

Plant height min0.3 m

Seed mass1.15 mg

Life cycle & reproduction3

Life formtuberous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 700 m

Elevation min0 m

Epiphyteterrestrial

Fruit typecapsule

Growth formherb

Leaf shapestrap-shaped

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gladiolus tristis has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

matKHQ394383.1 ↗837 bp

ACGT

TTATGTATCAGATATACTAATACCCCATCCCATTCATATGGAAATCTTGGTTCAAATCCTTCAATGCTGGATTCAAGATGTTCCCCTTTT …

Gladiolus tristis maturase K (matK) gene, partial cds; plastid

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Gladiolus tristis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 30 n = 15

Ploidydiploid inferred

Chromosome records30–302n range30median30mode7records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 307×CCDB · ipcn-api-dl · CCDB · book-fedorov · CCDB · Oberlander2016

CCDB · ipcn-api-dl — Bareka, E. P., T. Constantinidis & G. Kamari. 1998. Mediterraean chromosome number reports 8 (1001--1008). Fl. Medit. 8: 298–307.

CCDB · ipcn-api-dl — Ohri, D. & T. N. Khoshoo. 1985. Cytogenetics of garden Gladiolus II. Variation in chromosome complement and meiotic system. Cytologia 50: 213–231.

CCDB · book-fedorov — Ernst-Schwarzenbach. 1931

CCDB · book-fedorov — Brittingham 1934

CCDB · book-fedorov — Bamford 1935

CCDB · book-fedorov — Mensinkai 1939b

CCDB · Oberlander2016 — Ohri, & Khoshoo, 1985;Bareka, Constantinidis & Kamari, 1998

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type767 records

Wild obs. + sensor522

Museum / vouchered243

Cultivated / captive2

Origin

Native1

Introduced95

Range

Area of Occupancy AOO1 892 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 352≤1 km 58≤10 km 37>10 km 14

461 georeferenced · 61 without coordinates

Open the mapobservation + sensor522

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy54% within 1 km

≤100 m 14≤1 km 55≤10 km 52>10 km 6

127 georeferenced · 116 without coordinates

Open the institutions mapphysical evidence243

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	46
Adelaide, AU	34
Museo Entomologico de Leonlocation not on record	31
Cape Town, ZA	30
Canberra, AU	20
Cape Town, ZA	19
Hobart, AU	16
Kensington, AU	11
La Trobe Universitylocation not on record	5
Mount Annan, AU	4
Kew, GB	3
Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record	2
Barcelona, ES	2
Claremont, US	2
Córdoba, AR	2
Christchurch, NZ	2
MSB-3054location not on record	1
Universität Göttingenlocation not on record	1
Auckland, NZ	1
Museo della Bonifica di San Donà di Piavelocation not on record	1
San Luis Obispo, US	1
Minia, EG	1
Zürich, CH	1
San Isidro, AR	1
Brisbane, AU	1
Riverside, US	1
QVMAGlocation not on record	1

27 institutions · 240 of 243 vouchered records shown · 3 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Gladiolus tristis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)