Gladiolus caryophyllaceus

(Burm.f.) Poir. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Gladiolus

At a glance

Occurrence records1 060

Data sources7

Biological traits31

DNA specimens1

eDNA detections1

Sources7 archives

Databases and archives Gladiolus caryophyllaceus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 060 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources31 traits

Occurrence & distributionGBIF1 060 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Gladiolus caryophyllaceus is a Gladiolus species native to the Cape Provinces in South Africa.Govaerts, R. et al. (2018) Plants of the world online: Gladiolus caryophyllaceus. Board of Trustees of the Royal Botanic Gardens, Kew It is a weed in Western Australia.GBIF: Occurrence data for Gladiolus caryophyllaceusFloraBase: Gladiolus caryophyllaceus

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology10

Fruit length25 mm

Leaf length235 mm

Leaf mass per area108 g/m2

Leaf width15 mm

Plant height0.525 m

Plant height max1 m

Plant height min0.2 m

Seed mass3.38 mg

⚠ sources differ — TRY: 3.38 mg · GIFT: 3.6 mg

Seed mass max3.6 mg

Seed mass min3.6 mg

Life cycle & reproduction5

DeciduousnessN

Life formtuberous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Resprouting capacityresprouts

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max920 m

Elevation min30 m

Epiphyteterrestrial

Fruit typecapsule

Growth formherb

Leaf shapeensiform falcate lanceolate

Woodinessnon-woody

Physiology & chemistry4

Leaf n19.02 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)11.47 mm²/mg

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gladiolus caryophyllaceus has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

matKHQ394282.1 ↗849 bp

ACGT

TTATGTATCAGATATACTAATACCCCATCCCATTCATATGGAAATCTTGGTTCAAATCCTTCAATGCTGGATTCAAGATGTTCCCCTTTT …

Gladiolus caryophyllaceus maturase K (matK) gene, partial cds; plastid

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

08Occurrence & distribution

Record type1 060 records

Wild obs. + sensor918

Museum / vouchered142

Origin

Introduced82

Range

Area of Occupancy AOO1 616 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 588≤1 km 247≤10 km 19>10 km 15

869 georeferenced · 49 without coordinates

Open the mapobservation + sensor918

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤100 m 18≤1 km 14≤10 km 39>10 km 2

73 georeferenced · 69 without coordinates

Open the institutions mapphysical evidence142

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	59
Cape Town, ZA	24
Pretoria, ZA	21
Canberra, AU	11
Cape Town, ZA	8
Museo Entomologico de Leonlocation not on record	4
BGPAlocation not on record	4
Joondalup, AU	2
Mount Annan, AU	2
MSB-3054location not on record	2
Adelaide, AU	2
Zürich, CH	1
Kew, GB	1

13 institutions · 141 of 142 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Gladiolus caryophyllaceus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Gladiolus caryophyllaceus

At a glance

Sources7 archives

Size & morphology10

Life cycle & reproduction5

Diet & foraging1

Habitat & environment10

Physiology & chemistry4

Other traits1

At a glance

Record type1 060 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 13 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 060 records