Gladiolus carneus

D.Delaroche · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Gladiolus

At a glance

Occurrence records2 423

Data sources8

Biological traits36

DNA specimens6

eDNA detections5

Sources8 archives

Databases and archives Gladiolus carneus's data was compiled from.

GBIFGlobal Biodiversity Information Facility2 423 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements4 literature sources36 traits

Occurrence & distributionGBIF2 423 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB2n = 30

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology10

Leaf length600 mm

Leaf length max600 mm

Leaf length min200 mm

Leaf width20 mm

Leaf width max20 mm

Leaf width min6 mm

Plant height0.8 m

Plant height max0.8 m

Plant height min0.2 m

Seed mass1.54 mg

⚠ sources differ — TRY: 1.54 mg · GIFT: 1.2 mg

Life cycle & reproduction12

Dispersal typeunspecialized

Flowering endNov

Flowering startOct

Flowering timennnnnnnnnyyn

Life formtuberous geophyte

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formcryptophyte

Resprouting capacityresprouts

Self fertilizationabsent

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 220 m

Elevation min10 m

Epiphyteterrestrial

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Leaf shapeensiform

Woodinessnon-woody

Other traits2

Plant support typefree-standing

Seeds per fruit11-100

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gladiolus carneus has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes3

GenBank sequences3

eDNA detections5

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLHM850029.1 ↗1 363 bpPortugal

ACGT

CTGGTGTTAAAGATTACAGATTGACTTATTATACTCCGGAGTACGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTC …

Gladiolus carneus ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1★rbcLa

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Gladiolus carneus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 30 n = 15

Ploidydiploid inferred

Chromosome records30–302n range30median30mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 303×CCDB · ipcn-api-dl · CCDB · book-fedorov

CCDB · ipcn-api-dl — Verryn, S. D. 1988. Chromosome number reports XCIX. Taxon 37: 396–397.

CCDB · book-fedorov — Bamford 1935

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type2 423 records

Wild obs. + sensor2 062

Museum / vouchered353

Cultivated / captive8

Origin

Native1

Introduced40

Range

Area of Occupancy AOO2 448 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 1 464≤1 km 269≤10 km 73>10 km 15

1 821 georeferenced · 241 without coordinates

Open the mapobservation + sensor2 062

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy71% within 1 km

≤100 m 23≤1 km 19≤10 km 16>10 km 1

59 georeferenced · 294 without coordinates

Open the institutions mapphysical evidence353

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 8 records without

Open the mapnot free-living8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	108
Cape Town, ZA	72
Cape Town, ZA	65
Canberra, AU	16
Adelaide, AU	13
Christchurch, NZ	9
Mount Annan, AU	8
Museo Entomologico de Leonlocation not on record	8
GHPG$location not on record	7
Auckland, NZ	7
Kensington, AU	7
Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record	5
Civico Museo di Scienze naturali Giuseppe Orlandilocation not on record	4
Zürich, CH	2
Rotorua, NZ	2
Armidale, AU	2
University of Johannesburglocation not on record	2
Batemans Bay, AU	2
Hobart, AU	1
Wollongong, AU	1
South African National Biodiversity Institutelocation not on record	1
Universität Göttingenlocation not on record	1
MSB-3054location not on record	1
Kew, GB	1

24 institutions · 345 of 353 vouchered records shown · 6 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA5 detections

Where the DNA of Gladiolus carneus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.1 °C 12.8–15.4

Seasonal swing summer↔winter11.2 °C

Max temp (day)17.5 °C 14.6–20.5

Min temp (night)10.6 °C 10.4–10.8

Precipitation109 mm/mo 70.4–149

Air humidity60.3 % 57.7–62.8

Moisture balance3.40 mm/mo -28.0–34.9

Vapour deficit675 Pa 547–804

Wind speed4.60 m/s 2.90–6.20

Cloud cover27.3 % 13.4–41.2

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Gladiolus carneus

At a glance

Sources8 archives

Size & morphology10

Life cycle & reproduction12

Diet & foraging1

Habitat & environment11

Other traits2

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 423 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions16 of 24 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 423 records