Gladiolus alatus

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Gladiolus

At a glance

Occurrence records1 479

Data sources9

Biological traits24

DNA specimens2

eDNA detections2

Sources9 archives

Databases and archives Gladiolus alatus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 479 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources24 traits

Occurrence & distributionGBIF1 479 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 30

01Narrative

گلایول جنوب آفریقا(نام علمی: Gladiolus alatus) نام یک گونه از سرده گلایول است.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology8

Leaf length215 mm

Leaf width7 mm

Plant height0.225 m

Plant height max0.35 m

Plant height min0.1 m

Seed mass0.997 mg

⚠ sources differ — TRY: 0.997 mg · GIFT: 1.11 mg

Seed mass max1.26 mg

Seed mass min0.88 mg

Life cycle & reproduction3

Life formtuberous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 200 m

Elevation min30 m

Epiphyteterrestrial

Fruit typecapsule

Growth formherb

Leaf shapeensiform

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gladiolus alatus has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences1

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

matKHQ394260.1 ↗849 bp

ACGT

TTATGTATCAGATATACTAATACCCCATCCCATTCATATGGAAATCTTGGTTCAAATCCTTCAATGCTGGATTCAAGATGTTCCCCTTTT …

Gladiolus alatus maturase K (matK) gene, partial cds; plastid

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Gladiolus alatus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 30 n = 15

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 301×CCDB · book-fedorov

CCDB · book-fedorov — Bamford 1935

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 479 records

Wild obs. + sensor1 328

Museum / vouchered149

Cultivated / captive2

Origin

Introduced1

Range

Area of Occupancy AOO2 260 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 940≤1 km 122≤10 km 39>10 km 30

1 131 georeferenced · 197 without coordinates

Open the mapobservation + sensor1 328

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy11% within 1 km

≤100 m 1≤10 km 7>10 km 1

9 georeferenced · 140 without coordinates

Open the institutions mapphysical evidence149

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	61
Cape Town, ZA	44
Cape Town, ZA	20
Zürich, CH	4
Zürich, CH	4
GHPG$location not on record	3
Kensington, AU	3
Kew, GB	1
University of Johannesburglocation not on record	1
MSB-3054location not on record	1
Philadelphia, US	1
Mount Annan, AU	1
BRNUlocation not on record	1
Moscow State Universitylocation not on record	1
Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record	1
Adelaide, AU	1

16 institutions · 148 of 149 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Gladiolus alatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.5 °C 12.5–12.5

Seasonal swing summer↔winter10.6 °C

Max temp (day)17.8 °C

Min temp (night)7.10 °C

Precipitation37.2 mm/mo

Air humidity59.5 %

Moisture balance-61.5 mm/mo

Vapour deficit585 Pa

Wind speed3.90 m/s

Cloud cover12.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Gladiolus alatus

At a glance

Sources9 archives

Size & morphology8

Life cycle & reproduction3

Diet & foraging1

Habitat & environment10

Physiology & chemistry1

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 479 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions10 of 16 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 479 records