Gillenia stipulata

(Muhl. ex Willd.) Bergmans · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rosaceae/Gillenia

At a glance

Occurrence records1 317

Data sources11

Biological traits8

DNA specimens4

eDNA detections4

Sources11 archives

Databases and archives Gillenia stipulata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 317 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources8 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF1 317 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB494 Mbp

01Narrative

Gillenia stipulata, or American ipecac, is a plant in the genus Gillenia, in the Rosaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction4

Flowering endAug

Flowering startJun

Life formperennial

Life spanperennial

Habitat & environment4

Climatetemperate

Climberself-supporting

Growth formForb/herb, Subshrub

Woodinessnon-woody

03Chemical composition1 compounds

Compounds documented for Gillenia stipulata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Simple phenolic acids1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
protocatechuate		present	LOTUS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gillenia stipulata has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences10

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSDQ811763.1 ↗485 bp

ACGT

TCGAACCTGCCCAGCAGAACGACCCGAGAACCGGTTTCAACGCCCCGGGGGGCGTGTCGGCGGGCCTCCGGGGCCGCCGCCGCCCCCCGT …

Gillenia stipulata internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL5★ITS3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Gillenia stipulata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size493 890 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Gillenia stipulata0.49 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 181×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Smith, E. B. 1985. Chromosome Number Reports LXXXVIII. Taxon 34: 547–551.

08Occurrence & distribution

Record type1 317 records

Wild obs. + sensor1 246

Museum / vouchered69

Other2

Range

Area of Occupancy AOO3 200 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 719≤1 km 113≤10 km 65>10 km 152

1 049 georeferenced · 197 without coordinates

Open the mapobservation + sensor1 246

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy54% within 1 km

≤100 m 8≤1 km 26≤10 km 27>10 km 2

63 georeferenced · 6 without coordinates

Open the institutions mapphysical evidence69

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wuzhou, CN	36
Bloomington, US	25
Austin, US	6
Millersville, US	2

4 institutions · 69 of 69 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Gillenia stipulata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Gillenia stipulata

At a glance

Sources11 archives

Life cycle & reproduction4

Habitat & environment4

Compound class profile1 class

Documented compounds1 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type1 317 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 4 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 317 records