Gillbeea adenopetala

F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Oxalidales/Cunoniaceae/Gillbeea

At a glance

Occurrence records331

Data sources6

Biological traits29

DNA specimens8

eDNA detections4

Sources6 archives

Databases and archives Gillbeea adenopetala's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility331 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources29 traits

Occurrence & distributionGBIF331 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI8 specimens

01Narrative

Gillbeea adenopetala là một loài thực vật có hoa trong họ Cunoniaceae. Loài này được F.Muell. mô tả khoa học đầu tiên năm 1865.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology12

Fruit length20 mm

Fruit width15 mm

Leaf length115 mm

Leaf mass per area116 g/m2

Leaf size3 929 mm²

Leaf width67.5 mm

Plant height35 m

⚠ sources differ — AusTraits: 35 m · TRY: 24.63 m

Seed length6 mm

Seed mass9 mg

Seed mass max15 mg

Seed mass min2.9 mg

Seed width2 mm

Life cycle & reproduction5

Deciduousnessevergreen

Flowering timennnnnnyyyyyy

Life formtree

Life spanperennial

Sex typehermaphrodite

Habitat & environment7

Climatewet tropical

Climberself-supporting

Fruit fleshinessdry

Fruit typesamara

Growth formtree

Leaf compoundnesscompound

Woodinesswoody

Physiology & chemistry5

Leaf n11.92 mg/g

Leaf p1.28 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)7.94 mm²/mg

Wood density456 mg/cm³

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gillbeea adenopetala has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes5

GenBank sequences2

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKF496454.1 ↗552 bpAustralia · 2013

ACGT

AGTGTTGGATTCAAGGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGCA …

Gillbeea adenopetala isolate BATT154-10 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL2★rbcLa★ITS2trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type331 records

Wild obs. + sensor30

Museum / vouchered272

Other29

Origin

Native11

Range

Area of Occupancy AOO588 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 8≤1 km 10≤10 km 2

20 georeferenced · 10 without coordinates

Open the mapobservation + sensor30

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy34% within 1 km

≤100 m 19≤1 km 54≤10 km 109>10 km 35

217 georeferenced · 55 without coordinates

Open the institutions mapphysical evidence272

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Smithfield, AU	90
Brisbane, AU	53
Museo Entomologico de Leonlocation not on record	24
Canberra, AU	17
Zürich, CH	14
Hobart, AU	13
Mount Annan, AU	10
Palmerston, AU	7
Kew, GB	5
James Cook Townsvillelocation not on record	5
Philadelphia, US	3
Australian Tropical Herbariumlocation not on record	2
Adelaide, AU	2
San Jose State University, Museum of Birds and Mammalslocation not on record	1
University of Stellenboschlocation not on record	1
Saint Louis, US	1
Honolulu, US	1
ASUlocation not on record	1

18 institutions · 250 of 272 vouchered records shown · 21 without an institution code

09Environmental DNA4 detections

Where the DNA of Gillbeea adenopetala was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.1 °C 22.3–26.2

Seasonal swing summer↔winter6.90 °C

Max temp (day)27.8 °C 26.5–28.3

Min temp (night)21.9 °C 16.4–24.8

Precipitation95.2 mm/mo 31.5–236

Air humidity63.0 % 47.3–64.6

Moisture balance-99.8 mm/mo

Vapour deficit1,229 Pa 1,132–1,545

Wind speed4.00 m/s

Cloud cover28.3 % 20.1–47.4

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)