Gilbertiodendron dewevrei

(De Wild.) J.Léonard · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Gilbertiodendron

At a glance

Occurrence records615

Data sources11

Biological traits23

DNA specimens7

eDNA detections5

Sources11 archives

Databases and archives Gilbertiodendron dewevrei's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility615 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources23 traits

Occurrence & distributionGBIF615 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceCCDB2n = 24

01Narrative

Gilbertiodendron dewevrei is a species of tree in the family Fabaceae, native to tropical rain forests in Central Africa. It is often the dominant tree species of the Guineo-Congolian rainforest. The timber is traded as limbali, and is used for construction, flooring and railway sleepers. It is also used for making boats, furniture, tool handles and joinery and for making charcoal.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height35 m

⚠ sources differ — GIFT: 35 m · TRY: 21.44 m

Plant height max40 m

Life cycle & reproduction5

Deciduousnessevergreen

Flowering endvariable

Flowering startvariable

Life formtree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Mycorrhiza typeectomycorrhizal

Woodinesswoody

Physiology & chemistry8

Leaf C:N ratio21.92 g/g

Leaf c465 mg/g

Leaf dry-matter content (LDMC)478 mg/g

Leaf n21.97 mg/g

Leaf p1.11 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density675 mg/cm³

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gilbertiodendron dewevrei has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes4

GenBank sequences10

eDNA detections5

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKY306577.1 ↗816 bp

ACGT

GATCGCGGCGACGTGGGCGGTTCGCTGCCGGCGACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAG …

Gilbertiodendron dewevrei voucher Wieringa 7555 (WAG) 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK6★rbcL1★rbcLa★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Gilbertiodendron dewevrei carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 121×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Husaini, S. W. & L. S. Gill. 1985. Cyto-geography of arborescent species of Caesalpinioideae (Leguminosae) from Nigeria. J. Tree Sci. 4: 7–14.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type615 records

Wild obs. + sensor95

Museum / vouchered520

Range

Area of Occupancy AOO1 016 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 2≤10 km 1

3 georeferenced · 92 without coordinates

Open the mapobservation + sensor95

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 18>10 km 1

19 georeferenced · 501 without coordinates

Open the institutions mapphysical evidence520

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MeiseBGlocation not on record	157
LBVlocation not on record	50
BRLUlocation not on record	41
Yaoundé, CM	32
Saint Louis, US	29
Herbier National du Gabonlocation not on record	14
WAGlocation not on record	14
Paris, FR	12
Brussels, BE	11
Centre de Recherche en Sciences Naturelles (CRSN/Lwiro)location not on record	10
Adam Mickiewicz University in Poznańlocation not on record	9
Kew, GB	8
Forest Herbarium Ibadan (FHI)location not on record	6
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	6
IPHAMETRAlocation not on record	5
LUKI_INERAlocation not on record	5
Plocation not on record	5
University of Santo Tomas Museumlocation not on record	3
Beijing, CN	1
Pretoria, ZA	1
Berlin, DE	1
Limbe Botanical & Zoological Gardenslocation not on record	1
Glocation not on record	1
Université de Kisanganilocation not on record	1
National Natural History Collectionslocation not on record	1
University of Oxfordlocation not on record	1
Elocation not on record	1
Universite Libre de Bruxelles, Herbariumlocation not on record	1
National Botanical Gardens of Belgiumlocation not on record	1
Edinburgh, GB	1

30 institutions · 429 of 520 vouchered records shown · 91 without an institution code

09Environmental DNA5 detections

Where the DNA of Gilbertiodendron dewevrei was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.1 °C 24.0–25.2

Seasonal swing summer↔winter1.70 °C

Max temp (day)29.1 °C 28.8–29.9

Min temp (night)20.6 °C 20.6–21.4

Precipitation140 mm/mo 64.5–145

Air humidity66.3 % 65.3–67.9

Moisture balance21.8 mm/mo -53.2–30.4

Vapour deficit1,009 Pa 960–1,112

Wind speed0.9 m/s 0.8–1.30

Cloud cover46.9 % 39.1–51.5

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)