Geum urbanum
speciesAt a glance
Occurrence records849 993
Data sources13
Biological traits59
DNA specimens51
eDNA detections26
Sources13 archives
Databases and archives Geum urbanum's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility849 993 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI26 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics51 specimens↗
NCBIUS National Library of Medicinesequences↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources59 traits
Chemical compositionNPASS11 compounds
Occurrence & distributionGBIF849 993 records
Environmental DNA1 datasets · 7 countries26 detections
DNA & barcodingBOLD · NCBI51 specimens
Genome at a glanceCCDB · GoaT · NCBI1.6 Gbp
01Narrative
La benoîte commune ou benoîte urbaine, également appelée herbe de saint Benoît ou herbe du bon soldat, est une espèce de plantes à fleurs de la famille des Rosaceae. Elle se trouve dans toute la France continentale et en Corse, particulièrement dans les endroits frais tels que les haies, les sous-bois, les ourlets nitrophiles et seulement hygrophiles. On peut la rencontrer également de façon très abondante près des décharges.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology19
Fruit length3.5 mm
Leaf length225 mm
Leaf length max300 mm
Leaf length min150 mm
Leaf mass152 mg
Leaf size3 586 mm²
Petiole length12.5 cm
Plant height0.384 m
⚠ sources differ — GIFT: 0.384 m · AusTraits: 0.75 m · LEDA: 0.4 m · TRY: 0.477 m
Plant height generative0.57 m
Plant height max1 m
Plant height min0.3 m
Seed length8.15 mm
⚠ sources differ — TRY: 8.15 mm · AusTraits: 3.5 mm
Seed mass1.92 mg
⚠ sources differ — TRY: 1.92 mg · AusTraits: 1.99 mg · LEDA: 2.45 mg · GIFT: 1.96 mg
Seed mass max4.1 mg
Seed mass min0.73 mg
Seed volume7.3 mm³
Seed volume max7.3 mm³
Seed volume min7.3 mm³
Seed width2 mm
Life cycle & reproduction18
Deciduousnessdeciduous
⚠ sources differ — TRY: deciduous · GIFT: evergreen
Dehiscenceindehiscent
Dispersal typeanimal
Flowering endJul
Flowering startMay
Flowering timeyynnnnnnnnny
Life formperennial
Life spanperennial
Lifespan years2 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Reproductive maturity1 years
Resprouting capacityresprouts
Seed number441
Self fertilizationabsent
Sex typehermaphrodite+monoecious
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment11
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typeachene
Growth formherb
Habitat GIFTforestedges,parks
Leaf compoundnesscompound
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry8
Leaf C:N ratio30.84 g/g
Leaf c418 mg/g
Leaf dry-matter content (LDMC)268 mg/g
⚠ sources differ — TRY: 268 mg/g · LEDA: 302 mg/g
Leaf n21.74 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)33.14 mm²/mg
⚠ sources differ — TRY: 33.14 mm²/mg · LEDA: 40.9 mm²/mg · GIFT: 38.46 mm²/mg
Wood density224 mg/cm³
Other traits1
Diaspore typeone-seeded generative dispersule
03Chemical composition11 compounds
Compounds documented for Geum urbanum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cooking
Compound class profile2 classes
Miscellaneous meroterpenoids3
Flavanones1
Documented compounds11 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| 1,2,3-Benzenetriol | present | NPASS | |
| 1-[2-(2-Hydroxypropan-2-yl)-7-(3-methylbut-2-enyl)-1-benzofuran-5-yl]ethanone | present | NPASS | |
| 1-[5-Acetyl-2-(2-hydroxypropan-2-yl)-1-benzofuran-7-yl]-3-methylbut-2-en-1-one | present | NPASS | |
| 1-[5-Acetyl-2-(2-hydroxypropan-2-yl)-1-benzofuran-7-yl]-3-methylbutan-1-one | present | NPASS | |
| 1-[5-acetyl-2-hydroxy-3-[(E)-3-hydroxy-3-methylbut-1-enyl]phenyl]-3-methylbutan-1-one | present | NPASS | |
| 1-[7-[(2S)-2,3-dihydroxy-3-methylbutyl]-2-(2-hydroxypropan-2-yl)-1-benzofuran-5-yl]ethanone | present | NPASS | |
| 12-Hydroxy-2,3-dihydroeuparin | present | NPASS | |
| ODHCTXKNWHHXJC-GSVOUGTGSA-M | present | NPASS | |
| QUZPTVPAUHASLU-ZBFHGGJFSA-N | present | NPASS | |
| Sakuranetin | present | NPASS |
05DNA & barcoding51 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Geum urbanum has left across the world's sequence archives.
At a glance
DNA specimens51
Marker genes9
GenBank sequences10
eDNA detections26
Countries8
The DNA barcodea real sequence read deposited for this species
GTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATCAGGCCGAGGGCACGTCTGCCTGGGCGTCACACGTCGTTGCCCCCCT …
Geum urbanum voucher PLT.0540 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK1★rbcL6★rbcLa★trnL-F★ITS3★ITS1★ITS2cp-trnL-intron
animal barcodeplant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Geum urbanum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 603 920 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Geum urbanum1.6 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 42 n = 21
Ploidypolyploid inferred
Chromosome records28–422n range42median42mode84records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 4283×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl +14
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J. et al., 1970a: Index of chromosome numbers of Slovakian flora (Part 1). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 16: 1-26.
CCDB · slov-fl — Hallonová A., 1982: Floristické pomery horskej skupiny Skalky (Strážovské vrchy). - Stredné Slovensko 2: 308-323.
CCDB · iapt
CCDB · brit-fl — Hollingsworth, P.M., Gornall, R.J., Bailey, J.P. Watsonia 19: 134-137 (1992)
CCDB · brit-fl — Al-Bermani, A.-K.K.A., Al-Shammary, K.I.A., Bailey, J.P., Gornall, R.J. Watsonia 19: 269-271 (1993)
CCDB · brit-fl — Wentworth, J.E., Bailey, J.P., Gornall, R.J. Watsonia 18: 415-418 (1991)
CCDB · brit-fl — Bailey, J.P., Gornall, R.J. Bot. J. Scotl. : ()
CCDB · iber-fl — Cytotaxomy of spanish plants. III.-Dicotyledons Lve, A. & E. Kjellqvist.Lagascalia4(1): 3-32(1974).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2653
CCDB · poland — Gajewski W. 1948. On the chromosome pairing in six hybrids among four Geum species. Acta Soc.\nBot. Pol. 19, 245-250.
CCDB · mediterranean
CCDB · ipcn-api-dl — Dmitrieva, S. A. & V. I. Parfenov. 1985. Kariologicheskaja kharakteristika nekotorykh vidov poleznykh rastenij flory Belorussii. Izv. Akad. Nauk Belorussk. SSR, Ser. Biol. Nauk 6: 3–8.
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — Kartashova, N. N., L. A. MALAKHOVA, Koslova & N. A. Dubrova. 1974. Chisla chromosom u rjada polesnykh rastenij is prirodnykh populjacij flory Priob'ja. Biol. Biofis. Tomsk. 47–53.
CCDB · ipcn-api-dl — Wentworth, J. E., J. P. Bailey & R. J. Gornall. 1991. Contributions to a cytological catalogue of the British and Irish flora, 1. Watsonia 18: 415–417.
CCDB · ipcn-api-dl — Queirós, M. 1991. Números cromossómicos para a flora Portuguesa. 104--105. Bol. Soc. Brot., sér. 2 64: 135–142.
CCDB · ipcn-api-dl — Kiehn, M., E. Vitek, E. Hellmayr, J. Walter, J. Tschenett, C. Justin & M. Mann. 1991. Beiträge zur Flora von Österreich: Chromosomenzählungen. Verh. Zool.-Bot. Ges. Wien 128: 19–39.
CCDB · ipcn-api-dl — Baltisberger, M., A. Mullaj & V. Tartari. 1993. Mediterranean chromosome number reports 3 (185--203). Fl. Medit. 3: 348–353.
CCDB · ipcn-api-dl — Van Loon, J. C. & A. K. V. Setten. 1982. IN: IOPB Plant chromosome number reports. Taxon 31: 589–592.
CCDB · ipcn-api-dl — Al-Bermani, A. K. K. A., K. I. A. Al-Shammary, R. J. Gornall & J. P. Bailey. 1993. Contribution to a cytological catalogue of the British and Irish flora, 3. Watsonia 19: 169–171.
CCDB · ipcn-api-dl — Hollingsworth, P. M., R. J. Gornall & J. P. Bailey. 1992. Contribution to a cytological catalogue of the British and Irish flora, 2. Watsonia 19: 134–137.
CCDB · ipcn-api-dl — Dobea, C., B. Hahn & W. Morawetz. 1997. Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5–43.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1981. In Chromosome number reports LXXIII. Taxon 30: 829–842.
CCDB · ipcn-api-dl — Van Loon, J. C. 1980. In Chromosome number reports LXIX. Taxon 29: 718–720.
CCDB · ipcn-api-dl — Van Loon, J. C. & B. Kieft. 1980. In Chromosome number reports LXVIII. Taxon 29: 538–542.
CCDB · ipcn-api-dl — KLIPHUIS, E. & J. H. Wieffering. 1979. In IOPB chromosome number reports LXIV. Taxon 28:398–400.
CCDB · ipcn-api-dl — Magulaev, A. J. 1979a. The chromosome numbers of flowering plants in the Northern Caucasus. Part 3. Flora of the North Caucasus and questions of its history,. 3: 101–106.
CCDB · ipcn-api-dl — Gurzenkov, N. N. 1973. Studies of chromosome numbers of plants from the south of the Soviet Far East. Komarov Lectures. 20: 47–61.
CCDB · ipcn-api-dl — Baltisberger. 2006. Cytological investigations on Bulgarian phanerogams. Willdenowia 36(Special Issue): 205–216.
CCDB · book-ipcn67-71 — MAJOVSKY, J., ET. AL. 1970. Index of chromosome numbers of Slovakian flora (Part 1). Acta Fae. Rerum Nat. Univ. Comenianae Bot. 16.: 1-26.
CCDB · book-ipcn67-71 — GADELLA, Th. W. J., & E. KLIPHUIS. 1966.' Chromosome numbers of flowering plants in the Netherlands II. Proc. Roy. Neth. Acad. Sci. Ser. C. 69: 541-556.
CCDB · book-ipcn75-78 — Ceschmedjiev 1976
CCDB · book-ipcn75-78 — Loon & Jong 1978
CCDB · book-ipcn75-78 — Kargashova et al. 1974
CCDB · book-ipcn73-74 — LOEVE, A., & E. KJELLQVIST. 1974. Cytotaxonomy of Spanish plants. III Dicotyledons: Salicaceae - Rosaceae. Lagascalia 4: 3-32.
CCDB · book-atlas-flowering-plants
CCDB · kew — Pustahija F, Brown SC, Bogunic F, Bašic N, Muratovic E, Ollier S, Hidalgo O, Bourge M, Stevanovic V, Sijak-Yakovev S. 2013. Small genomes dominate in plants growing on serpentine soils in West Balkans, an exhaustive study of 8 habitats covering 308 taxa.
+42 more references
2n 211×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Dmitrieva, S. A. (2000). Karyology of the flora of Byelarus Page 42 Thesis of the Diss. Doc. Biol. Sci. Minsk. Minsk
2n 281×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Davlianidze, M. T. 1985. Chromosome numbers in the representatives of the flora from Georgia. Bot. Zhurn. SSSR 70(5): 698–700. (In Russian).
n 214×CCDB · book-ipcn67-71 · CCDB · Cave1957 · CCDB · CromoCat 2015
CCDB · book-ipcn67-71 — LAANE, M.M. 1969. Further chromosome studies in Norwegian vascular plants. Blyttia 27: 5-17.
CCDB · Cave1957 — Gajewski
CCDB · CromoCat 2015 — Cauderon, Y. (1958). Étude cytogénétique des Agropyrum français et de leurs hybrides avec les blés. Ann. Inst. Natl. Rech. Agron., Ser. B. 8: 389-543.
CCDB · CromoCat 2015 — Laane, M. M. (1969a). Further chromosome studies in Norwegian vascular plants. Blyttia 27: 5-17.
n 141×CCDB · iapt
CCDB · iapt — IAPT/IOPB Chromosome Data 14
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness98.7% BUSCO
08Occurrence & distribution
Record type849 993 records
Wild obs. + sensor827 786
Museum / vouchered17 500
Cultivated / captive486
Other4 221
Origin
Native38 705
Introduced14
Range
Area of Occupancy AOO662 552 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy44% within 1 km
≤100 m 161 705≤1 km 143 084≤10 km 376 785>10 km 4 688
686 262 georeferenced · 141 524 without coordinates
Open the mapobservation + sensor827 786
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy34% within 1 km
≤100 m 742≤1 km 3 755≤10 km 8 030>10 km 871
13 398 georeferenced · 4 102 without coordinates
Open the institutions mapphysical evidence17 500
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy19% within 1 km
≤100 m 3≤1 km 2≤10 km 3>10 km 18
26 georeferenced · 460 without coordinates
Open the mapnot free-living486
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions112 of 229 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 9 568 |
| BFLlocation not on record | 654 |
| Helsinki, FI | 614 |
| BIO-UNIPIlocation not on record | 515 |
| Olocation not on record | 329 |
| LDlocation not on record | 307 |
| Moscow State Universitylocation not on record | 249 |
| Salzburg, AT | 222 |
| MeiseBGlocation not on record | 222 |
| Trondheim, NO | 202 |
| Berlin, DE | 195 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 162 |
| Bergen, NO | 154 |
| Turku, FI | 119 |
| Adam Mickiewicz University in Poznańlocation not on record | 114 |
| Uniwersytet Warszawskilocation not on record | 109 |
| Görlitz, DE | 100 |
| SLU Artdatabankenlocation not on record | 93 |
| Oskarshamn, SE | 91 |
| KMNlocation not on record | 90 |
| Tartu, EE | 85 |
| Barcelona, ES | 84 |
| Entomological Society of Latvialocation not on record | 83 |
| València, ES | 82 |
| BDBClocation not on record | 82 |
| Kuopio, FI | 79 |
| Tallinn, EE | 77 |
| Oulu, FI | 72 |
| Provincia di Livornolocation not on record | 68 |
| Université Lavallocation not on record | 62 |
| Wlocation not on record | 55 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 55 |
| BRNUlocation not on record | 53 |
| San Sebastián, ES | 52 |
| MAlocation not on record | 49 |
| BClocation not on record | 47 |
| TUR-Alocation not on record | 40 |
| South Kensington, GB | 39 |
| Vitoria, ES | 39 |
| Voronezh State Universitylocation not on record | 38 |
| Jyväskylä, FI | 33 |
| Mount Annan, AU | 31 |
| Salamanca, ES | 29 |
| WTUlocation not on record | 27 |
| Mlocation not on record | 26 |
| Uppsala, SE | 26 |
| TROMlocation not on record | 25 |
| Bern, CH | 25 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 22 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 22 |
| CICYTEXlocation not on record | 21 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 21 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 19 |
| Santiago de Compostela, ES | 18 |
| Karlsruhe, DE | 16 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 15 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 15 |
| Ann Arbor, US | 14 |
| Frankfurt am Main | 13 |
| Museo Achille Folettolocation not on record | 13 |
| Madrid, ES | 13 |
| Uniwersytet Śląski w Katowicachlocation not on record | 12 |
| Porvoo, FI | 12 |
| Corvallis, US | 12 |
| Natural History Museum Rotterdamlocation not on record | 11 |
| Zürich, CH | 11 |
| Porrentruy, CH | 11 |
| Moscow, US | 11 |
| Bronx, US | 11 |
| QAUlocation not on record | 10 |
| GZUlocation not on record | 10 |
| Québec, CA | 10 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 9 |
| Pamplona, ES | 9 |
| Pamplona, ES | 9 |
| Madison, US | 9 |
| Canberra, AU | 9 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 9 |
| Auckland, NZ | 9 |
| Saint John, CA | 9 |
| Granada, ES | 8 |
| Uniwersytet Opolskilocation not on record | 8 |
| Uniwersytet Jagiellońskilocation not on record | 8 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 8 |
| CJBGlocation not on record | 8 |
| GJOlocation not on record | 8 |
| McWane Science Centerlocation not on record | 8 |
| College of the Atlantic, Museumlocation not on record | 8 |
| Tilburg, NL | 8 |
| Philadelphia, US | 8 |
| PrivatHerblocation not on record | 7 |
| Bourges, FR | 7 |
| Pullman, US | 7 |
| Stockholm, SE | 7 |
| IDElocation not on record | 7 |
| Durham, US | 7 |
| Toronto, CA | 7 |
| Boise, US | 6 |
| Chongqing Museumlocation not on record | 6 |
| Paris, FR | 6 |
| Sevilla, ES | 6 |
| Badajoz, ES | 6 |
| Portland, US | 6 |
| PRClocation not on record | 6 |
| Phyletisches Museum Jenalocation not on record | 6 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 6 |
| OLAlocation not on record | 6 |
| Kew, GB | 6 |
| Tula State Universitylocation not on record | 5 |
| Beijing, CN | 5 |
| Alicante, ES | 5 |
| Forssa, FI | 5 |
| Dresden, DE | 5 |
| RJBJCIlocation not on record | 5 |
| ISAlocation not on record | 5 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 5 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 4 |
| Hobart, AU | 4 |
| Wellington, NZ | 4 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 4 |
| Tromso University Museumlocation not on record | 4 |
| Caldwell, US | 4 |
| UGentlocation not on record | 4 |
| Whitehorse, CA | 4 |
| LfUlocation not on record | 4 |
| Christchurch, NZ | 4 |
| National Museum Waleslocation not on record | 4 |
| BGBMlocation not on record | 4 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 4 |
| Royal Botanical Gardenslocation not on record | 4 |
| Portland, US | 4 |
| Vancouver, CA | 4 |
| Columbia, US | 3 |
| Armidale, AU | 3 |
| nbflocation not on record | 3 |
| Parkville, AU | 3 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 3 |
| Winterthur, CH | 3 |
| Frauenfeld, CH | 3 |
| Rotorua, NZ | 3 |
| Burlington, US | 3 |
| University of Guelph, OAC Herbariumlocation not on record | 3 |
| Ivano-Frankove, UA | 3 |
| DBF-NHMDlocation not on record | 3 |
| Sant Julià de Lòria, AD | 3 |
| Sion, CH | 2 |
| Nijmegen, NL | 2 |
| Göteborg, SE | 2 |
| Jaén, ES | 2 |
| Museo Entomologico de Leonlocation not on record | 2 |
| Flagstaff, US | 2 |
| Brisbane, AU | 2 |
| Glarus, CH | 2 |
| *unvoucheredlocation not on record | 2 |
| Acadia Universitylocation not on record | 2 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 2 |
| Bangkok, TH | 2 |
| ESP109location not on record | 2 |
| Canadian Department of Agriculturelocation not on record | 2 |
| BSBIlocation not on record | 2 |
| Xiamen, CN | 2 |
| Fulda, DE | 2 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 2 |
| Trois-Rivières, CA | 2 |
| Saint Louis, US | 2 |
| Fort Worth, US | 2 |
| Zürich, CH | 2 |
| CIBIOlocation not on record | 1 |
| Podgorica, ME | 1 |
| Namur, BE | 1 |
| H-Lippertlocation not on record | 1 |
| St. Paul, US | 1 |
| POL003location not on record | 1 |
| Riverside, US | 1 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 1 |
| IWEP FEB RASlocation not on record | 1 |
| SNSNMClocation not on record | 1 |
| H-Schuhwlocation not on record | 1 |
| University of Hamburglocation not on record | 1 |
| ULBF-AGRlocation not on record | 1 |
| JBAlocation not on record | 1 |
| Gijón, ES | 1 |
| Banyoles, ES | 1 |
| SZUlocation not on record | 1 |
| Museum of the Rockieslocation not on record | 1 |
| JBRJlocation not on record | 1 |
| Logan, US | 1 |
| New Haven, US | 1 |
| Tampa, US | 1 |
| Claremont, US | 1 |
| CEPLAClocation not on record | 1 |
| ROM020location not on record | 1 |
| Montréal, CA | 1 |
| Adelaide, AU | 1 |
| GMBAlocation not on record | 1 |
| FLADlocation not on record | 1 |
| Brookings, US | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| UoB-IBlocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| Musée des Confluenceslocation not on record | 1 |
| UNINE:NEUlocation not on record | 1 |
| Lausanne, CH | 1 |
| Davenport, US | 1 |
| Umeå Universitylocation not on record | 1 |
| Naturalis Biodiversity Centerlocation not on record | 1 |
| Anchorage, US | 1 |
| John May Museum of Natural Historylocation not on record | 1 |
| National Botanic Garden of Waleslocation not on record | 1 |
| Chicago, US | 1 |
| B.A. Bennett Herbariumlocation not on record | 1 |
| Sede dell'Orto botanico del Museo di Storia naturale dell'Università degli Studi di Parmalocation not on record | 1 |
| Research Center in Biodiversity and Genetic Resourceslocation not on record | 1 |
| US | 1 |
| SWlocation not on record | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Natural History Museum, Tribhuvan Universitylocation not on record | 1 |
| Kunming, CN | 1 |
| DULlocation not on record | 1 |
| H-AkrKGlocation not on record | 1 |
| HUN003location not on record | 1 |
| ASUlocation not on record | 1 |
| Allentown, US | 1 |
| Bloomington, US | 1 |
| Wuzhou, CN | 1 |
| University of Alberta Museumslocation not on record | 1 |
| Taipei, TW | 1 |
| Oswego, US | 1 |
| John T. Waterhouse Herbariumlocation not on record | 1 |
229 institutions · 16 431 of 17 500 vouchered records shown · 660 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA26 detections
Where the DNA of Geum urbanum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found26
Studies independent surveys1
Countries7
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 26 detections have coordinates
Open the map7 countries0
under Quercus montanaRich riparian soil with a mixture of deciduo…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median14.2 °C 11.8–19.2
Seasonal swing summer↔winter16.6 °C
Max temp (day)17.2 °C 13.5–24.2
Min temp (night)10.7 °C 8.50–14.9
Precipitation81.3 mm/mo 53.9–121
Air humidity61.2 % 57.8–63.6
Moisture balance-34.0 mm/mo -51.5–17.8
Vapour deficit641 Pa 504–931
Wind speed3.80 m/s 2.40–4.40
Cloud cover44.6 % 40.1–65.4
CHELSA 1981–2010, ~9 km grid, at location & month of 21 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.