Geum rivale
speciesAt a glance
Occurrence records312 701
Data sources14
Biological traits130
DNA specimens38
eDNA detections19
Sources14 archives
Databases and archives Geum rivale's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility312 701 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics38 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources130 traits
Chemical compositionLOTUS9 compounds
Occurrence & distributionGBIF312 701 records
Environmental DNA1 datasets · 5 countries19 detections
DNA & barcodingBOLD · NCBI38 specimens
Genome at a glanceCCDB · GoaT · NCBI1.3 Gbp
01Narrative
La Benoîte des ruisseaux est une espèce de plantes à fleurs de la famille des Rosaceae.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDAUSDATRYWCVP
Size & morphology16
Leaf length65 mm
Leaf length max90 mm
Leaf length min40 mm
Leaf mass288 mg
Leaf size9 605 mm²
⚠ sources differ — TRY: 9 605 mm² · LEDA: 6 428 mm² · GIFT: 6 428 mm²
Leaf width55 mm
Leaf width max80 mm
Leaf width min30 mm
Plant height0.614 m
⚠ sources differ — GIFT: 0.614 m · LEDA: 0.35 m · USDA: 0.914 m · TRY: 0.4 m
Plant height generative0.496 m
Plant height max1 m
Plant height min0.15 m
Seed length9.43 mm
Seed mass1.09 mg
Seed mass max1.34 mg
Seed mass min0.53 mg
Life cycle & reproduction38
After harvest regrowth rateSlow
Bloom periodMid Spring
Coppice potentialNo
Deciduousnessdeciduous
⚠ sources differ — TRY: deciduous · GIFT: evergreen
Dehiscenceindehiscent
Dispersal typeanimal
Flower colourpurple
Flower conspicuousYes
Flower length max25 mm
Flower length min20 mm
Flowering endJul
Flowering startMay
Fruit seed period beginSpring
Fruit seed period endSummer
Growth rate USDAModerate
Life formperennial
Life spanperennial
⚠ sources differ — TRY: perennial · LEDA: poly-annuals 5-50 years (medium-lived perennials) · GIFT: perennial
Lifespan categoryModerate
Lifespan years5 years
Pollination modebiotic
Pollination syndromeinsect
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Resprout abilityNo
Seed number243
Seed spread rateModerate
Seedling vigorMedium
Self fertilizationabsent
Vegetative spread rateNone
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment30
Active growth periodSpring and Summer
Adapted to coarse textured soilsYes
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max2 300 m
Elevation mean1 750 m
Elevation min1 200 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerModerate
Foliage porosity winterPorous
Foliage textureCoarse
Fruit colourbrown
Fruit typeachene
Growth formherb
Growth form USDASingle Crown
Habitat GIFTforest, lakes, meadows: wet, rivers, shrubberies, swamps
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Mycorrhiza typearbuscular
Root depth min12 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry26
Anaerobic toleranceMedium
C:N ratioMedium
Caco3 toleranceMedium
Cold stratification requiredNo
Drought toleranceLow
Fertility requirementHigh
Fire resistantNo
Fire toleranceMedium
Frost free days min95 days
Leaf C:N ratio13.69 g/g
Leaf c437 mg/g
Leaf dry-matter content (LDMC)269 mg/g
⚠ sources differ — TRY: 269 mg/g · LEDA: 237 mg/g
Leaf n24.52 mg/g
Leaf p2.0 mg/g
Moisture useHigh
Nitrogen fixation levelNone
Photosynthetic pathwayC3
Precipitation max55 in
Precipitation min30 in
Salinity toleranceNone
Seed longevity index0
Shade toleranceHigh
Soil pH max7 pH
Soil pH min4.8 pH
Specific leaf area (SLA)19.61 mm²/mg
Temperature min-33 °F
Uses & economy13
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound400 000 per lb
ToxicityNone
Veneer productNo
Other traits5
Diaspore typegenerative dispersule
Fall conspicuousNo
Fruit seed abundanceHigh
Fruit seed conspicuousNo
Fruit seed persistenceNo
03Chemical composition9 compounds
Compounds documented for Geum rivale across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Flavonols2
Ursane and Taraxastane triterpenoids2
Oleanane triterpenoids1
Disaccharides1
Cinnamic acids and derivatives1
Documented compounds9 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Ursolic Acid | present | LOTUS | |
| Aesculetin | present | LOTUS | |
| Gallic acid | present | LOTUS | |
| Kaempferol | present | LOTUS | |
| methyl (1S,2S,4aS,4bR,6aS,9R,10R,10aR,12aS)-10-hydroxy-2-(1-methoxy-2-methyl-1-oxopropan-2-yl)-1-(2-methoxy-2-oxoethyl)-1,4a,4b,9,10-pentamethyl-3,4,5,6,7,8,9,10a,12,12a-decahydro-2H-chrysene-6a-carboxylate | present | LOTUS | |
| Oleanolic acid | present | LOTUS | |
| Quercetin | present | LOTUS | |
| Sugars | present | LOTUS | |
| trans-Caffeic acid | present | LOTUS |
05DNA & barcoding38 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Geum rivale has left across the world's sequence archives.
At a glance
DNA specimens38
Marker genes6
GenBank sequences10
eDNA detections19
Countries6
The DNA barcodea real sequence read deposited for this species
TGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATCAGGCCGAGGGCACGTC …
Geum rivale isolate N13 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL3★rbcLa★ITS4★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Geum rivale carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 261 620 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Geum rivale1.26 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 42 n = 21
Ploidypolyploid inferred
Chromosome records16–422n range42median42mode49records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 4245×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · slov-fl · CCDB · iapt +15
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · slov-fl — Májovský J. et al., 1970b: Index of chromosome numbers of Slovakian flora Part 2. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 18: 45-60.
CCDB · iapt — IAPT/IOPB Chromosome Data 13
CCDB · brit-fl — Bailey, J.P., Gornall, R.J. Bot. J. Scotl. : ()
CCDB · brit-fl — Al-Bermani, A.-K.K.A., Al-Shammary, K.I.A., Bailey, J.P., Gornall, R.J. Watsonia 19: 269-271 (1993)
CCDB · brit-fl — Bailey, J.P., Gornall, R.J. Irish Naturalists' J. : ()
CCDB · iber-fl — Cytotaxomy of spanish plants. III.-Dicotyledons Lve, A. & E. Kjellqvist.Lagascalia4(1): 3-32(1974).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2652
CCDB · fl-europaea — Gajewski, 1957
CCDB · poland — Gajewski W. 1948. On the chromosome pairing in six hybrids among four Geum species. Acta Soc.\nBot. Pol. 19, 245-250.
CCDB · ipcn-api-dl — Laane, M. M. & T. Lie. 1985. Fremstilling av kromosompreparater med enkle metoder. Blyttia 1985: 7–15.
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: A Löve (ed.), IOPB chromosome number reports LXXV. Taxon 31(2): 344–360.
CCDB · ipcn-api-dl — Dmitrieva, S. A. & V. I. Parfenov. 1983. Khromosomnye chisla nekotorykh vidov flory Belorussii. Izv. Akad. Nauk Belorussk. SSR, Ser. Biol. Nauk 2: 7–12.
CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1983. Chromosome numbers in flowering plants from Greece. Willdenowia 13: 329–333.
CCDB · ipcn-api-dl — Krasnikov, A. A. 1991. Chromosome numbers in some species of vascular plants from Novosibirsk region. Bot. Žhurn. (Moscow & Leningrad) 76: 476–479.
CCDB · ipcn-api-dl — Al-Bermani, A. K. K. A., K. I. A. Al-Shammary, R. J. Gornall & J. P. Bailey. 1993. Contribution to a cytological catalogue of the British and Irish flora, 3. Watsonia 19: 169–171.
CCDB · ipcn-api-dl — Dobea, C., B. Hahn & W. Morawetz. 1997. Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5–43.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · book-ipcn72 — ENGELSKJOEN, T., & G. KNABEN. 1971. Chromosome numbers of Scandinavian arctic-alpine plant species. III. Acta Boreal., A, Scientia No. 28: 1-30.
CCDB · book-ipcn67-71 — GADELLA, Th. W.J., & E. KLIPHUIS. 1968. Chromosome numbers of flowering plants in the Netherlands IV. Proc. Roy. Netherlands Acad. Sci. ser. C. 71: 168-183.
CCDB · book-ipcn67-71 — MAJOVSKY, J., ET. AL. 1970. Index of chromosome numbers of Slovakian flora. (Part 2). Acta Fae. Rerum Nat. Univ. Comenianae Bot. 18: 45-60.
CCDB · book-ipcn67-71 — GADELLA, T.W.J., & E. KLIPHUIS. 1971. In IOPB chromosome number reports XXXI. Taxon 20: 157-160-:--
CCDB · book-ipcn75-78 — Peev 1977
CCDB · book-ipcn75-78 — Ceschmedjiev 1976
CCDB · book-northern-plants — L. & L. (unpubl.).
CCDB · book-ipcn73-74 — LOEVE, A., & E. KJELLQVIST. 1974. Cytotaxonomy of Spanish plants. III Dicotyledons: Salicaceae - Rosaceae. Lagascalia 4: 3-32.
CCDB · book-atlas-flowering-plants — Raynor 1952 ,,
CCDB · Cave1957 — Gajewski
CCDB · Cave1963 — Sokol. & Strel. 1962; Sorsa 1963c
CCDB · CromoCat 2015 — Chepinoga, V. V., Gnutikov, A. A., Lubogoschinsky, P. I. & Fleckenstein, K. M. (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:889-891
CCDB · CromoCat 2015 — Al-Bermani, A.-K. K. A., Al-Shammary, K. I. A., Gornall, R. J. & Bailey, J. P. (1993). Contribution to a cytological catalogue of the British and Irish flora, 3. Watsonia 19: 169-171.
CCDB · CromoCat 2015 — Arohonka, T. (1982). Kromosomilukumäärityksiä Nauvon Seilin saaren putkilokasveista. (Chromosome counts of vascular plants of the island Seiliin Nauvo, SW Finland) Turun Yliopiston Biologian Laitoksen Julkaisuja 3: 1-12.
CCDB · CromoCat 2015 — Cesmedziev, I. (1976). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LIV]. Taxon 25(5/6): 642-643.
CCDB · CromoCat 2015 — Dmitrieva, S. A. & Parfenov, V. I. (1983). Khromosomnye chisla nekotorykh vidov flory Belorussii. Izv. Akad. Nauk Belorussk. SSR, Ser. Biol. Nauk (Minsk) 2: 7-12.
CCDB · CromoCat 2015 — Dobeš, C., Hahn, B. & Morawetz, W. (1997). Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5-43.
CCDB · CromoCat 2015 — Gadella, Th. W. J. & Kliphuis, E. (1971a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XXXI]. Taxon 20(1): 157-160.
CCDB · CromoCat 2015 — Krasnikov, A. A. (1991). Chromosome numbers in some species of vascular plants from Novosibirsk region. Bot. Žurn. 76: 476-479.
CCDB · CromoCat 2015 — Laane, M. M. & Lie, T. (1985). Fremstilling av kromosompreparater med enkle metoder. Blyttia 1985: 7-15.
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1982b). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXV]. Taxon 31(2): 344-360.
+5 more references
2n 162×CCDB · book-ipcn66 · CCDB · kew
CCDB · book-ipcn66 — Joseph & Heimburger 1966
CCDB · kew — Rothfels K, Sexsmith E, Heimburg.M, Krause MO. 1966. Chromosome size and DNA content of species of Anemone L and related genera (Ranunculaceae). Chromosoma 20: 54-74.
2n 241×CCDB · book-atlas-flowering-plants
CCDB · book-atlas-flowering-plants — Moffett 1932b
2n 361×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Tischler, G. (1950). Die chromosomenzhalen der GefäBpflanzen Mitteleuropas. s'-Gravenhage: W. Junk. 263
n 218×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · Cave1957 +3
CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · book-ipcn67-71 — LAANE, M.M. 1969. Meiosis and structural hybridity in some Norwegian plant species. Blyttia 27: 141-173.
CCDB · Cave1957 — Gajewski
CCDB · Cave1963 — Sorsa 1962
CCDB · CromoCat 2015 — Javurková-Jarolímová, V. (1992). List of Chromosome Numbers of the Czech Vascular Plants. In J. Mesíccek & V. Javurková-Jarolímová. Academia, Praha Praha
CCDB · CromoCat 2015 — Laane, M. M. (1969b). Meiosis and structural hybridity in some Norwegian plant species. Blyttia 27: 141-173.
CCDB · CromoCat 2015 — M?sí?ek J. et Jarolímová-Jav?rková V. (1992). List of chromosome numbers of the Czech vascular plants. Academia, Praha. p. 1-144.
CCDB · iapt — IAPT/IOPB Chromosome Data 35
n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Chepinoga, V. V., Gnutikov, A. A., Lubogoschinsky, P. I. & Fleckenstein, K. M. (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:889-891
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness98.6% BUSCO
08Occurrence & distribution
Record type312 701 records
Wild obs. + sensor296 238
Museum / vouchered14 260
Cultivated / captive58
Other2 145
Origin
Native15 970
Introduced71
Range
Area of Occupancy AOO423 552 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy67% within 1 km
≤100 m 107 750≤1 km 60 040≤10 km 79 100>10 km 1 834
248 724 georeferenced · 47 514 without coordinates
Open the mapobservation + sensor296 238
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy37% within 1 km
≤100 m 664≤1 km 3 273≤10 km 5 601>10 km 1 172
10 710 georeferenced · 3 550 without coordinates
Open the institutions mapphysical evidence14 260
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy15% within 1 km
≤100 m 1≤1 km 3≤10 km 4>10 km 19
27 georeferenced · 31 without coordinates
Open the mapnot free-living58
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions127 of 239 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 5 254 |
| Helsinki, FI | 853 |
| LDlocation not on record | 603 |
| Olocation not on record | 450 |
| Moscow State Universitylocation not on record | 430 |
| BFLlocation not on record | 323 |
| Salzburg, AT | 279 |
| Oulu, FI | 232 |
| Oskarshamn, SE | 232 |
| Trondheim, NO | 215 |
| Jyväskylä, FI | 180 |
| Turku, FI | 174 |
| SLU Artdatabankenlocation not on record | 165 |
| Québec, CA | 164 |
| Bergen, NO | 157 |
| MeiseBGlocation not on record | 120 |
| Tartu, EE | 114 |
| TROMlocation not on record | 113 |
| Chongqing Museumlocation not on record | 103 |
| Garðabær, IS | 100 |
| KMNlocation not on record | 97 |
| Université Lavallocation not on record | 96 |
| Kuopio, FI | 95 |
| Adam Mickiewicz University in Poznańlocation not on record | 86 |
| GJOlocation not on record | 85 |
| St. Paul, US | 85 |
| Madison, US | 77 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 69 |
| Ann Arbor, US | 67 |
| University of New Hampshirelocation not on record | 63 |
| Tallinn, EE | 63 |
| Burlington, US | 62 |
| Philadelphia, US | 62 |
| Uniwersytet Jagiellońskilocation not on record | 61 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 52 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 49 |
| TUR-Alocation not on record | 49 |
| Görlitz, DE | 49 |
| Entomological Society of Latvialocation not on record | 47 |
| València, ES | 47 |
| Frankfurt am Main | 46 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 44 |
| Provincia di Livornolocation not on record | 43 |
| Wlocation not on record | 43 |
| Bronx, US | 42 |
| 42 | |
| New Haven, US | 42 |
| Barcelona, ES | 41 |
| BIO-UNIPIlocation not on record | 40 |
| Montréal, CA | 39 |
| Bern, CH | 38 |
| BDBClocation not on record | 38 |
| Saint John, CA | 37 |
| South Kensington, GB | 36 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 36 |
| Missoula, US | 36 |
| Uppsala, SE | 35 |
| BRNUlocation not on record | 33 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 30 |
| Voronezh State Universitylocation not on record | 30 |
| Porvoo, FI | 29 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 28 |
| University of Alberta Museumslocation not on record | 28 |
| Uniwersytet Warszawskilocation not on record | 26 |
| Denver, US | 23 |
| Berlin, DE | 22 |
| Toronto, CA | 22 |
| WTUlocation not on record | 21 |
| Kandalaksha State Nature Reservelocation not on record | 19 |
| Acadia Universitylocation not on record | 18 |
| Urumqi, CN | 17 |
| DBF-NHMDlocation not on record | 17 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 16 |
| BClocation not on record | 16 |
| Porrentruy, CH | 16 |
| MAlocation not on record | 15 |
| Mlocation not on record | 14 |
| Vitoria, ES | 14 |
| PRClocation not on record | 14 |
| Beijing, CN | 14 |
| Glarus, CH | 13 |
| Salamanca, ES | 13 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 12 |
| Bloomington, US | 12 |
| Stockholm, SE | 12 |
| Green Bay, US | 12 |
| Rovaniemi, FI | 12 |
| Albuquerque, US | 12 |
| Wuzhou, CN | 11 |
| Philadelphia, US | 11 |
| Winterthur, CH | 11 |
| Uniwersytet Opolskilocation not on record | 11 |
| GZUlocation not on record | 10 |
| Durham, US | 10 |
| Bozeman, US | 10 |
| SZUlocation not on record | 9 |
| Frauenfeld, CH | 9 |
| New Brunswick, US | 9 |
| University of Lethbridgelocation not on record | 9 |
| Bangkok, TH | 9 |
| Fulda, DE | 9 |
| Tampa, US | 8 |
| Staten Island, US | 8 |
| San Sebastián, ES | 8 |
| Paris, FR | 8 |
| Tula State Universitylocation not on record | 8 |
| Moscow, US | 8 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 8 |
| BSBIlocation not on record | 7 |
| nbflocation not on record | 7 |
| Vancouver, CA | 7 |
| Dresden, DE | 7 |
| Christchurch, NZ | 7 |
| Montréal, CA | 7 |
| WINlocation not on record | 7 |
| Granada, ES | 7 |
| UoB-IBlocation not on record | 6 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 6 |
| Wellington, NZ | 6 |
| Uniwersytet Śląski w Katowicachlocation not on record | 6 |
| Forssa, FI | 6 |
| Bourges, FR | 6 |
| Rocky Mountain Biological Laboratorylocation not on record | 5 |
| Badajoz, ES | 5 |
| CJBGlocation not on record | 5 |
| Brussel, BE | 5 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 5 |
| Museo Achille Folettolocation not on record | 5 |
| Herb. BBGlocation not on record | 5 |
| Natural History Museum Rotterdamlocation not on record | 5 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 5 |
| Madrid, ES | 4 |
| Alicante, ES | 4 |
| Tromso University Museumlocation not on record | 4 |
| Karlsruhe, DE | 4 |
| Dekalb, US | 4 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 4 |
| University of Stellenboschlocation not on record | 3 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| Saint Louis, US | 3 |
| Sion, CH | 3 |
| Boise, US | 3 |
| Tilburg, NL | 3 |
| DOI/NPS, Greenbelt Parklocation not on record | 3 |
| Davenport, US | 3 |
| Brookings, US | 3 |
| PrivatHerblocation not on record | 3 |
| Sant Julià de Lòria, AD | 3 |
| National Museum Waleslocation not on record | 3 |
| Victoria, CA | 3 |
| Millersville, US | 3 |
| Pullman, US | 2 |
| Kingston, US | 2 |
| Gijón, ES | 2 |
| Royal Botanic Garden Edinburghlocation not on record | 2 |
| Royal Ontario Museum, Green Plant Herbarium (TRT)location not on record | 2 |
| Lausanne, CH | 2 |
| Flagstaff, US | 2 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 2 |
| Whitehorse, CA | 2 |
| Hamilton, US | 2 |
| Claremont, US | 2 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 2 |
| Göteborg, SE | 2 |
| Monastir, TN | 2 |
| NMBU:MINAlocation not on record | 2 |
| CICYTEXlocation not on record | 2 |
| H-Schuhwlocation not on record | 2 |
| Orem, US | 2 |
| Durango, US | 2 |
| John May Museum of Natural Historylocation not on record | 2 |
| Trois-Rivières, CA | 2 |
| Podgorica, ME | 2 |
| Oswego, US | 2 |
| Musée des Confluenceslocation not on record | 2 |
| Spearfish, US | 2 |
| USFS/BHSClocation not on record | 2 |
| Phyletisches Museum Jenalocation not on record | 2 |
| Ypsilanti, US | 2 |
| Uniwersytet w Białymstokulocation not on record | 2 |
| Ivano-Frankove, UA | 2 |
| FLADlocation not on record | 2 |
| Jaén, ES | 2 |
| Lubbock, US | 1 |
| Santiago de Compostela, ES | 1 |
| Mount Pleasant, US | 1 |
| Jena Microbial Resource Collectionlocation not on record | 1 |
| Walla Walla, US | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| Boumlocation not on record | 1 |
| Mississippi State, US | 1 |
| Research Collection of B. A. Bennettlocation not on record | 1 |
| Allentown, US | 1 |
| Museum of the Rockieslocation not on record | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| CSBSJUlocation not on record | 1 |
| BAYLUlocation not on record | 1 |
| CASlocation not on record | 1 |
| München, DE | 1 |
| Embrapa Amazônia Oriental, Ministry of Agriculturelocation not on record | 1 |
| Royal Botanical Gardenslocation not on record | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| *unvoucheredlocation not on record | 1 |
| Pamplona, ES | 1 |
| Pamplona, ES | 1 |
| College of the Atlantic, Museumlocation not on record | 1 |
| Auckland, NZ | 1 |
| Pittsburg, US | 1 |
| Tempe, US | 1 |
| Royal Alberta Museumlocation not on record | 1 |
| H-AkrKGlocation not on record | 1 |
| Philadelphia, US | 1 |
| IPE-CSIClocation not on record | 1 |
| Keene State Universitylocation not on record | 1 |
| AUAlocation not on record | 1 |
| Baysgarth Museumlocation not on record | 1 |
| Zürich, CH | 1 |
| McWane Science Centerlocation not on record | 1 |
| Santa Barbara, US | 1 |
| Nijmegen, NL | 1 |
| NMWlocation not on record | 1 |
| Kew, GB | 1 |
| Edinburgh, GB | 1 |
| LfUlocation not on record | 1 |
| European Distributed Institute of Taxonomy (EDIT)location not on record | 1 |
| ULBF-AGRlocation not on record | 1 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 1 |
| Phoenix, US | 1 |
| Emporia, US | 1 |
| San Angelo, US | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Brock University (BU)location not on record | 1 |
| Pomona Collegelocation not on record | 1 |
| Sede dell'Orto botanico del Museo di Storia naturale dell'Università degli Studi di Parmalocation not on record | 1 |
| Logan, US | 1 |
| Zürich, CH | 1 |
| Namur, BE | 1 |
| Meguro Parasitological Museumlocation not on record | 1 |
| Xiamen, CN | 1 |
239 institutions · 13 387 of 14 260 vouchered records shown · 725 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA19 detections
Where the DNA of Geum rivale was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found19
Studies independent surveys1
Countries5
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 19 detections have coordinates
Open the map5 countries0
Moist meadow, adjacent to stream, dominated …
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median11.7 °C 9.20–14.7
Seasonal swing summer↔winter12.5 °C
Max temp (day)14.5 °C 10.4–18.8
Min temp (night)8.80 °C 6.70–10.6
Precipitation77.2 mm/mo 59.8–112
Air humidity63.0 % 57.5–65.2
Moisture balance-10.7 mm/mo
Vapour deficit514 Pa 416–712
Wind speed3.60 m/s
Cloud cover50.9 % 43.0–62.4
CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.