Geum reptans

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rosaceae/Geum

At a glance

Occurrence records10 776

Data sources10

Biological traits27

DNA specimens1

eDNA detections1

Sources10 archives

Databases and archives Geum reptans's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility10 776 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources27 traits

Chemical compositionLOTUS11 compounds

Occurrence & distributionGBIF10 776 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 42

01Narrative

Geum reptans, la benoîte rampante ou benoite rampante, est une espèce de plantes à fleurs de la famille des Rosaceae, originaire des Alpes, des Carpates et des Balkans.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTLEDATRYWCVP

Size & morphology5

Plant height0.075 m

Plant height generative0.09 m

Plant height max0.1 m

Plant height min0.05 m

Seed mass0.924 mg

⚠ sources differ — TRY: 0.924 mg · LEDA: 0.85 mg · GIFT: 0.85 mg

Life cycle & reproduction8

Deciduousnessdeciduous

⚠ sources differ — TRY: deciduous · GIFT: evergreen

Dispersal typeanimal

⚠ sources differ — LEDA: epizoochor · GIFT: anemochorous

Flowering endAug

Flowering startJul

Life formperennial

Life spanperennial

Lifespan years25 years

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Growth formherb

Mycorrhiza type0.000000381

Woodinessnon-woody

Physiology & chemistry6

Leaf C:N ratio15.8 g/g

Leaf c475 mg/g

Leaf dry-matter content (LDMC)274 mg/g

Leaf n27.85 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)14.11 mm²/mg

⚠ sources differ — TRY: 14.11 mm²/mg · LEDA: 10.9 mm²/mg · GIFT: 10.9 mm²/mg

Other traits1

Diaspore typefruitlet

03Chemical composition11 compounds

Compounds documented for Geum reptans across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Unsaturated fatty acids6

Glycerophosphoglycerophosphoglycerols2

Glycerophosphoglycerols1

Branched fatty acids $ Unsaturated fatty acids1

Glycosyldiacylglycerols1

Documented compounds11 total

Tissue Source Quantified only

Compound	Amount	Source
(2S)-1-(octadecanoyloxy)-3-{[(2R,3R,4S,5S)-3,4,5-trihydroxy-6-({[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy}methyl)oxan-2-yl]oxy}propan-2-yl octadecanoate	present	LOTUS
[3-[[3-[2,3-Di(octadeca-9,12-dienoyloxy)propoxy-hydroxyphosphoryl]oxy-2-hydroxypropoxy]-hydroxyphosphoryl]oxy-2-octadeca-9,12-dienoyloxypropyl] octadeca-9,12-dienoate	present	LOTUS
alpha-Linolenic acid	present	LOTUS
Cardiolipin	present	LOTUS
Elaidolinolenic acid	present	LOTUS
Hexadecenoic acid	present	LOTUS
Linonelic acid	present	LOTUS
oleate	present	LOTUS
palmitate	present	LOTUS
Phosphatidyl Glycerol	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Geum reptans has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAJ302351.1 ↗608 bpSweden

ACGT

TCGAAACCTGCCCAGCAGAACCACAAGAGAACATGTTCAATGCTCGGGGAGGAGGGGCCTGTCCGCTCTTCCCCGCTTCTCGGGGGGTAC …

Geum reptans 5.8S rRNA gene, internal transcribed spacer 1 (ITS1) and internal transcribed spacer 2 (ITS2)

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Geum reptans carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 42 n = 21

Ploidypolyploid inferred

Chromosome records42–422n range42median42mode8records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 428×CCDB · slov-fl · CCDB · fl-europaea · CCDB · poland +4

CCDB · slov-fl — Májovský J. et al., 1976: Index of chromosome numbers of Slovakian flora (Part 5). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 25: 1-18.

CCDB · slov-fl — Uhríková A., 2007: [New records in Astragalus, Caltha, Cerastium, Dactylorhiza, Gagea, Genista, Geum, Knautia, Linaria, Lithospermum, Oryzopsis, Poa, Polygala, Sanguisorba, Scrophularia, Sorbus, and Vulpia], pp. 120, 140, 185, 221, 222, 272, 288, 293, 345, 371, 374, 424, 458, 460, 520, 533, 557, 558, 629. - In: Marhold K., Mártonfi P., Mereďa P. jun., Mráz P. (eds), Chromosome number survey of the ferns and flowering plants of Slovakia. Veda, Bratislava.

CCDB · fl-europaea — Gajewski, 1957

CCDB · poland — Gajewski W. 1952. The hybrids between two subgenera of Geum L. Acta Soc. Bot. Pol. 21, 480-516.

CCDB · ipcn-api-dl — Nikolov, N. A. 1991. Chromosome numbers of Bulgarian angiosperms from North Pirin Mountain: Reserve "Bajuvi Dupki--D|3zind|3zirica". Fitologija 41: 70–75.

CCDB · book-ipcn72 — LOVKA, M., F. SUSNIK, A. LOEVE, & D. LOEVE. 1972. In IOPB chromosome number reports XXXVI. Taxon 21: 333-346.

CCDB · book-ipcn75-78 — Vachova 1976

CCDB · Cave1957 — Gajewski

n 211×CCDB · Cave1957

CCDB · Cave1957 — Gajewski

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type10 776 records

Wild obs. + sensor10 118

Museum / vouchered523

Cultivated / captive1

Other134

Range

Area of Occupancy AOO8 464 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy32% within 1 km

≤100 m 2 161≤1 km 557≤10 km 5 521>10 km 388

8 627 georeferenced · 1 491 without coordinates

Open the mapobservation + sensor10 118

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 16≤1 km 85≤10 km 174>10 km 4

279 georeferenced · 244 without coordinates

Open the institutions mapphysical evidence523

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions24 of 47 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Salzburg, AT	81
GJOlocation not on record	70
Zürich, CH	55
BFLlocation not on record	38
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	30
Zürich, CH	27
LDlocation not on record	25
Mlocation not on record	23
Uniwersytet Wrocławskilocation not on record	19
Bern, CH	16
Adam Mickiewicz University in Poznańlocation not on record	12
Glarus, CH	12
Oskarshamn, SE	11
Wlocation not on record	10
Provincia di Livornolocation not on record	9
SZUlocation not on record	7
Uniwersytet Jagiellońskilocation not on record	7
GZUlocation not on record	6
BIO-UNIPIlocation not on record	5
BRNUlocation not on record	4
BClocation not on record	4
Görlitz, DE	4
Sion, CH	4
Frankfurt am Main	4
Uniwersytet Opolskilocation not on record	3
Wellington, NZ	2
BG-NMNHSlocation not on record	2
Christchurch, NZ	2
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	2
Sede dell'Orto botanico del Museo di Storia naturale dell'Università degli Studi di Parmalocation not on record	1
Saint Louis, US	1
Bourges, FR	1
Berlin, DE	1
Barcelona, ES	1
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	1
Auckland, NZ	1
Dhaka, BD	1
Porrentruy, CH	1
Wuzhou, CN	1
Naturhistorische Gesellschaft Nürnberg e.V.location not on record	1
MAlocation not on record	1
Podgorica, ME	1
Tilburg, NL	1
Pamplona, ES	1
Moscow State Universitylocation not on record	1
Brookings, US	1
Helsinki, FI	1

47 institutions · 512 of 523 vouchered records shown · 10 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Geum reptans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median3.50 °C 3.50–3.50

Seasonal swing summer↔winter23.1 °C

Max temp (day)6.80 °C

Min temp (night)-0.1 °C

Precipitation61.7 mm/mo

Air humidity63.5 %

Moisture balance17.8 mm/mo

Vapour deficit351 Pa

Wind speed2.40 m/s

Cloud cover51.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Geum reptans

At a glance

Sources10 archives

Size & morphology5

Life cycle & reproduction8

Diet & foraging1

Habitat & environment6

Physiology & chemistry6

Other traits1

Compound class profile5 classes

Documented compounds11 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type10 776 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions24 of 47 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type10 776 records