Geum macrophyllum
Willd. · speciesAt a glance
Occurrence records28 415
Data sources12
Biological traits96
DNA specimens26
eDNA detections14
Sources12 archives
Databases and archives Geum macrophyllum's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility28 415 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics26 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources96 traits
Chemical compositionLOTUS68 compounds
Occurrence & distributionGBIF28 415 records
Environmental DNA1 datasets · 4 countries14 detections
DNA & barcodingBOLD · NCBI26 specimens
Genome at a glanceCCDB1.2 Gbp
01Narrative
La Benoîte à grandes feuilles est une espèce de plantes à fleurs de la famille des Rosacées originaire d'Amérique du Nord.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesLEDAGIFTWCVPUSDATRY
Size & morphology6
Plant height0.61 m
⚠ sources differ — GIFT: 0.61 m · USDA: 0.61 m · TRY: 0.555 m
Plant height max0.75 m
Plant height min0.25 m
Seed mass0.633 mg
⚠ sources differ — TRY: 0.633 mg · GIFT: 0.596 mg
Seed mass max0.786 mg
Seed mass min0.42 mg
Life cycle & reproduction28
After harvest regrowth rateSlow
Bloom periodLate Spring
Coppice potentialNo
Dispersal typehuman
⚠ sources differ — LEDA: agochor · GIFT: unspecialized
Flower colouryellow
Flower conspicuousYes
Flowering endJul
Flowering startJun
Fruit seed period beginSummer
Fruit seed period endSummer
Growth rate USDAModerate
Life formperennial
Life spanperennial
Lifespan categoryModerate
Lifespan years2 years
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Resprout abilityNo
Seed spread rateModerate
Seedling vigorMedium
Vegetative spread rateNone
Diet & foraging1
Parasiteindependent
Habitat & environment24
Active growth periodSpring and Summer
Adapted to coarse textured soilsYes
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climberself-supporting
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerModerate
Foliage porosity winterPorous
Foliage textureCoarse
Fruit colourbrown
Growth formherb
Growth form USDARhizomatous
Habitat GIFTforest, rivers, shrubberies
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Root depth min12 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry20
Anaerobic toleranceLow
C:N ratioMedium
Caco3 toleranceMedium
Cold stratification requiredNo
Drought toleranceLow
Fertility requirementMedium
Fire resistantNo
Fire toleranceMedium
Frost free days min100 days
Leaf dry-matter content (LDMC)264 mg/g
Moisture useMedium
Nitrogen fixation levelNone
Photosynthetic pathwayC3
Precipitation max55 in
Precipitation min12 in
Salinity toleranceNone
Shade toleranceLow
Soil pH max7 pH
Soil pH min5 pH
Temperature min-33 °F
Uses & economy13
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound793 706 per lb
ToxicityNone
Veneer productNo
Other traits4
Fall conspicuousNo
Fruit seed abundanceHigh
Fruit seed conspicuousNo
Fruit seed persistenceNo
03Chemical composition68 compounds
Compounds documented for Geum macrophyllum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Gallotannins44
Ursane and Taraxastane triterpenoids9
Cinnamic acids and derivatives4
Oleanane triterpenoids4
Menthane monoterpenoids2
Documented compounds68 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| ((10R,11S,12R,13S,15R)-3,4,5,13,21,22,23-heptahydroxy-8,18-dioxo-12-(3,4,5-trihydroxybenzoyl)oxy-9,14,17-trioxatetracyclo(17.4.0.02,7.010,15)tricosa-1(23),2,4,6,19,21-hexaen-11-yl) 3,4,5-trihydroxybenzoate | present | LOTUS | |
| (+)-Ursolic Acid | present | LOTUS | |
| (10R,11R,13R,14R,15S)-3,4,5,11,14,20,21,22-octahydroxy-13-(hydroxymethyl)-9,12,16-trioxatetracyclo[16.4.0.02,7.010,15]docosa-1(22),2,4,6,18,20-hexaene-8,17-dione | present | LOTUS | |
| (14S,15S,19R)-14-[(10S,11R)-3,4,5,11,17,18,19-heptahydroxy-8,14-dioxo-9,13-dioxatricyclo[13.4.0.02,7]nonadeca-1(19),2,4,6,15,17-hexaen-10-yl]-2,3,4,7,8,9,19-heptahydroxy-13,16-dioxatetracyclo[13.3.1.05,18.06,11]nonadeca-1,3,5(18),6,8,10-hexaene-12,17-dione | present | LOTUS | |
| (14S,15S,19S)-14-[(10S,11S)-3,4,5,11,17,18,19-heptahydroxy-8,14-dioxo-9,13-dioxatricyclo[13.4.0.02,7]nonadeca-1(19),2,4,6,15,17-hexaen-10-yl]-2,3,4,7,8,9,19-heptahydroxy-13,16-dioxatetracyclo[13.3.1.05,18.06,11]nonadeca-1,3,5(18),6,8,10-hexaene-12,17-dione | present | LOTUS | |
| (1R,28R,31R,48S)-6,7,8,11,17,18,19,30,36,37,38,41,42,43-tetradecahydroxy-2,13,21,26,29,32,47-heptaoxanonacyclo[26.20.0.04,9.010,24.012,22.015,20.031,48.034,39.040,45]octatetraconta-4,6,8,10,12(22),15,17,19,23,34,36,38,40,42,44-pentadecaene-3,14,25,33,46-pentone | present | LOTUS | |
| (1R,2S,19R,22R)-7,8,9,12,13,14,20,28,29,30,33,34,35-tridecamethoxy-3,18,21,24,39-pentaoxaheptacyclo[20.17.0.02,19.05,10.011,16.026,31.032,37]nonatriaconta-5,7,9,11,13,15,26,28,30,32,34,36-dodecaene-4,17,25,38-tetrone | present | LOTUS | |
| (1R,4aS,8aS)-6-[[(1R,2S,4aR,6R,7R,8aR)-2-acetyl-6,7-dihydroxy-1,5,5,8a-tetramethyl-3,4,4a,6,7,8-hexahydro-1H-naphthalen-2-yl]methyl]-1,4a-dimethyl-2,3,4,8a-tetrahydronaphthalene-1-carboxylic acid | present | LOTUS | |
| (1S,2R,4aS,6aS,6aS,6bR,8aR,12aR,14bR)-1,2,6a,6b,9,9,12a-heptamethyl-10-oxo-1,2,3,4,5,6,6a,7,8,8a,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid | present | LOTUS | |
| (1S,4aS,8aR)-6-[[(1S,2R,4aS,6S,7S,8aS)-2-acetyl-6,7-dihydroxy-1,5,5,8a-tetramethyl-3,4,4a,6,7,8-hexahydro-1H-naphthalen-2-yl]methyl]-1,4a-dimethyl-2,3,4,8a-tetrahydronaphthalene-1-carboxylic acid | present | LOTUS |
05DNA & barcoding26 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Geum macrophyllum has left across the world's sequence archives.
At a glance
DNA specimens26
Marker genes6
GenBank sequences10
eDNA detections14
Countries5
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACACGTC …
Geum macrophyllum voucher CCDB-18335-F10 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL5★rbcLa★trnL-F★ITS3★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Geum macrophyllum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 173 600 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Geum macrophyllum1.17 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 42 n = 21
Ploidypolyploid inferred
Chromosome records42–842n range42median42mode13records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 4211×CCDB · iapt · CCDB · nw-europe-fl · CCDB · ipcn-api-dl +4
CCDB · iapt — IAPT/IOPB Chromosome Data 5
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2654
CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: A Löve (ed.), IOPB chromosome number reports LXXV. Taxon 31(2): 344–360.
CCDB · ipcn-api-dl — Dawe, J. C. & D. F. Murray. 1979. In IOPB chromosome number reports LXIII. Taxon 28: 265–268.
CCDB · ipcn-api-dl — Iwatsubo, Y. & N. Naruhashi. 1993. Karyotypes on five species of Japanese Geum (Rosaceae). Cytologia 58: 313–320.
CCDB · book-ipcn66 — Taylor & Brockman 1966
CCDB · book-ipcn67-71 — ZHUKOVA, P. G. 1967. Karyology of some plants, cultivated in the Arctic-Alpine Botanical Garden. (In Russian). In N. A. Avrorin (ed.): Plantarum in Zonam Polarem Transportatio. II. Leningrad 1967, pp. 139-149.
CCDB · book-ipcn67-71 — TAYLOR, R.L., & G.A. MULLIGAN. 1968. Flora of the Queen Charlotte Islands. Part 2. Cytological aspects of the Vascular Plants. Queen's Printer, Ottawa. pp. 148.
CCDB · book-atlas-flowering-plants — Gajewski 1949
CCDB · Cave1957 — Gajewski
2n 842×CCDB · Cave1957 · CCDB · Cave1963
CCDB · Cave1957 — Gajewski
CCDB · Cave1963 — Sokolovskaya 1963
n 211×CCDB · Cave1957
CCDB · Cave1957 — Gajewski
n 421×CCDB · Cave1957
CCDB · Cave1957 — Gajewski
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
polyploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
08Occurrence & distribution
Record type28 415 records
Wild obs. + sensor25 883
Museum / vouchered2 530
Cultivated / captive2
Origin
Native55
Introduced158
Range
Area of Occupancy AOO38 424 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy77% within 1 km
≤100 m 14 819≤1 km 2 506≤10 km 4 944>10 km 325
22 594 georeferenced · 3 289 without coordinates
Open the mapobservation + sensor25 883
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy57% within 1 km
≤100 m 265≤1 km 482≤10 km 413>10 km 141
1 301 georeferenced · 1 229 without coordinates
Open the institutions mapphysical evidence2 530
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy50% within 1 km
≤1 km 1≤10 km 1
2 georeferenced
Open the mapnot free-living2
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions93 of 152 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Bronx, US | 143 |
| Corvallis, US | 133 |
| Pullman, US | 121 |
| WTUlocation not on record | 120 |
| Moscow, US | 108 |
| Québec, CA | 93 |
| Boise, US | 90 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 83 |
| Missoula, US | 75 |
| Bergen, NO | 66 |
| Helsinki, FI | 61 |
| Claremont, US | 59 |
| Denver, US | 50 |
| Pocatello, US | 46 |
| Olocation not on record | 46 |
| Chongqing Museumlocation not on record | 45 |
| Vancouver, CA | 41 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 41 |
| Saint John, CA | 40 |
| Riverside, US | 39 |
| Burlington, US | 39 |
| Provo, US | 35 |
| Albuquerque, US | 31 |
| Moscow State Universitylocation not on record | 29 |
| LDlocation not on record | 27 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 27 |
| Victoria, CA | 22 |
| Portland, US | 22 |
| Davis, US | 22 |
| Bozeman, US | 22 |
| SLU Artdatabankenlocation not on record | 21 |
| University of Alberta Museumslocation not on record | 20 |
| Université Lavallocation not on record | 20 |
| Arcata, US | 20 |
| University of Lethbridgelocation not on record | 20 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 19 |
| Caldwell, US | 19 |
| Acadia Universitylocation not on record | 19 |
| Angwin, US | 18 |
| Rocky Mountain Biological Laboratorylocation not on record | 17 |
| Flagstaff, US | 17 |
| University of Stellenboschlocation not on record | 16 |
| CASlocation not on record | 15 |
| University of New Hampshirelocation not on record | 14 |
| Tacoma, US | 14 |
| Anchorage, US | 14 |
| Oulu, FI | 14 |
| Logan, US | 13 |
| Trondheim, NO | 12 |
| St. Paul, US | 11 |
| Montréal, CA | 11 |
| Ann Arbor, US | 11 |
| MeiseBGlocation not on record | 10 |
| Ashland, US | 10 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 10 |
| Tampa, US | 9 |
| KMNlocation not on record | 9 |
| ASUlocation not on record | 9 |
| Cheney, US | 8 |
| Canadian Department of Agriculturelocation not on record | 7 |
| Oskarshamn, SE | 7 |
| Bangkok, TH | 7 |
| Uppsala, SE | 7 |
| Pittsburg, US | 6 |
| Phoenix, US | 6 |
| San Diego, US | 6 |
| Nijmegen, NL | 5 |
| Pomona Collegelocation not on record | 5 |
| Keene State Universitylocation not on record | 5 |
| Bothell, US | 5 |
| Emporia, US | 5 |
| Spearfish, US | 5 |
| Paris, FR | 4 |
| IDElocation not on record | 4 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 4 |
| Davenport, US | 4 |
| Weber State Universitylocation not on record | 4 |
| Madison, US | 4 |
| DOI/FWS, Kenai National Wildlife Refugelocation not on record | 4 |
| Los Angeles, US | 4 |
| Orem, US | 4 |
| TROMlocation not on record | 4 |
| DOI/NPS, Greenbelt Parklocation not on record | 4 |
| Saint Louis, US | 3 |
| Santa Barbara, US | 3 |
| Bend, US | 3 |
| Truckee, US | 3 |
| INFlocation not on record | 3 |
| Uniwersytet Warszawskilocation not on record | 3 |
| US | 3 |
| Research Collection of B. A. Bennettlocation not on record | 3 |
| Toronto, CA | 3 |
| San Jose, US | 3 |
| University of British Columbia, Herbariumlocation not on record | 3 |
| Williamsburg, US | 2 |
| Millersville, US | 2 |
| Tromso University Museumlocation not on record | 2 |
| BSBIlocation not on record | 2 |
| Portland, US | 2 |
| Uniwersytet Jagiellońskilocation not on record | 2 |
| Severin-McDaniel Insect Collectionlocation not on record | 2 |
| Wuzhou, CN | 2 |
| Durango, US | 2 |
| USFS/BHSClocation not on record | 2 |
| Fredericton Stock Culture Collectionlocation not on record | 2 |
| US | 2 |
| Chicago, US | 2 |
| Whitewater, US | 2 |
| WINlocation not on record | 2 |
| Columbia, US | 2 |
| GB | 2 |
| Dekalb, US | 2 |
| San Angelo, US | 2 |
| Henderson, US | 1 |
| Pacific Lutheran Universitylocation not on record | 1 |
| Natural History Museum Rotterdamlocation not on record | 1 |
| BClocation not on record | 1 |
| Institute of the biological problems of the North FEB RASlocation not on record | 1 |
| STUlocation not on record | 1 |
| Obihiro Centennial City Museumlocation not on record | 1 |
| San Francisco, US | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| Tempe, US | 1 |
| Walla Walla, US | 1 |
| Guangzhou, CN | 1 |
| Austin, US | 1 |
| Grand Junction, US | 1 |
| Green Bay, US | 1 |
| Royal Alberta Museumlocation not on record | 1 |
| TUR-Alocation not on record | 1 |
| San Luis Obispo, US | 1 |
| VALElocation not on record | 1 |
| Umeå Universitylocation not on record | 1 |
| Voronezh State Universitylocation not on record | 1 |
| Stockholm, SE | 1 |
| Irvine, US | 1 |
| Chadron, US | 1 |
| DBF-NHMDlocation not on record | 1 |
| STNFlocation not on record | 1 |
| University of Guelph, OAC Herbariumlocation not on record | 1 |
| Trois-Rivières, CA | 1 |
| Kuopio, FI | 1 |
| Brussel, BE | 1 |
| Brookings, US | 1 |
| Wellington, NZ | 1 |
| Northridge, US | 1 |
| Long Beach, US | 1 |
| Durham, US | 1 |
| Adam Mickiewicz University in Poznańlocation not on record | 1 |
| 1 | |
| Science Museum of Minnesotalocation not on record | 1 |
| Turku, FI | 1 |
152 institutions · 2 426 of 2 530 vouchered records shown · 104 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA14 detections
Where the DNA of Geum macrophyllum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found14
Studies independent surveys1
Countries4
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 14 detections have coordinates
Open the map4 countries0
Wetland seep between food area and Lake shoreWetland near cabingrowing wild in grassland at RBGE
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median12.9 °C -2.20–15.0
Seasonal swing summer↔winter23.9 °C
Max temp (day)16.9 °C -1.00–22.0
Min temp (night)7.60 °C -3.80–10.5
Precipitation60.7 mm/mo 41.2–99.7
Air humidity58.1 % 51.8–62.8
Moisture balance-40.3 mm/mo -88.1–30.5
Vapour deficit632 Pa 192–842
Wind speed2.60 m/s 2.10–5.00
Cloud cover43.9 % 35.1–55.3
CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.