Geum laciniatum

Murray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rosaceae/Geum

At a glance

Occurrence records1 906

Data sources11

Biological traits87

DNA specimens5

eDNA detections2

Sources11 archives

Databases and archives Geum laciniatum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 906 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources87 traits

Occurrence & distributionGBIF1 906 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB2n = 42

01Narrative

Geum laciniatum (commonly named rough avens or hairy herb-bennet) is a member of the family Rosaceae. It is a perennial forb, native to eastern North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTUSDATRY

Size & morphology2

Plant height0.9 m

Seed mass1.26 mg

⚠ sources differ — TRY: 1.26 mg · GIFT: 1.13 mg

Life cycle & reproduction24

After harvest regrowth rateSlow

Bloom periodLate Spring

Coppice potentialNo

Flower colourwhite

Flower conspicuousYes

Fruit seed period beginSummer

Fruit seed period endSummer

Growth rate USDARapid

Life formperennial

Life spanperennial

Lifespan categoryModerate

Propagated by bare rootNo

Propagated by bulbNo

Propagated by containerNo

Propagated by cormNo

Propagated by cuttingsNo

Propagated by seedYes

Propagated by sodNo

Propagated by sprigsNo

Propagated by tubersNo

Resprout abilityNo

Seed spread rateModerate

Seedling vigorMedium

Vegetative spread rateNone

Diet & foraging1

Parasiteindependent

Habitat & environment24

Active growth periodSpring and Summer

Adapted to coarse textured soilsYes

Adapted to fine textured soilsYes

Adapted to medium textured soilsYes

Aquaticterrestrial

BloatNone

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Foliage colorGreen

Foliage porosity summerModerate

Foliage porosity winterPorous

Foliage textureCoarse

Fruit colourbrown

Growth formherb

Growth form USDAMultiple Stem

Hedge toleranceNone

Known allelopathNo

Leaf retentionNo

Low growing grassNo

Root depth min12 in

Shape and orientationErect

Small grainNo

Woodinessnon-woody

Physiology & chemistry19

Anaerobic toleranceLow

C:N ratioMedium

Caco3 toleranceMedium

Cold stratification requiredNo

Drought toleranceLow

Fertility requirementMedium

Fire resistantNo

Fire toleranceMedium

Frost free days min130 days

Moisture useMedium

Nitrogen fixation levelNone

Photosynthetic pathwayC3

Precipitation max55 in

Precipitation min36 in

Salinity toleranceNone

Shade toleranceMedium

Soil pH max7 pH

Soil pH min5 pH

Temperature min-23 °F

Uses & economy13

Berry nut seed productNo

Christmas tree productNo

Commercial availabilityRoutinely Available

Fodder productNo

Lumber productNo

Naval store productNo

Nursery stock productNo

Palatable humanNo

Post productNo

Pulpwood productNo

Seeds per pound400 000 per lb

ToxicityNone

Veneer productNo

Other traits4

Fall conspicuousNo

Fruit seed abundanceHigh

Fruit seed conspicuousNo

Fruit seed persistenceNo

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Geum laciniatum has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes5

GenBank sequences5

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMG236982.1 ↗332 bpCanada

ACGT

TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATCAGGCCGAGGGCACGTCTGCCTGGGCGTCACACGTC …

Geum laciniatum voucher CCDB-18317-E08 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★rbcLa★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Geum laciniatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 42 n = 21

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 421×CCDB · Cave1957

CCDB · Cave1957 — Gajewski

n 211×CCDB · Cave1957

CCDB · Cave1957 — Gajewski

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 906 records

Wild obs. + sensor1 191

Museum / vouchered714

Other1

Range

Area of Occupancy AOO6 560 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 739≤1 km 93≤10 km 27>10 km 102

961 georeferenced · 230 without coordinates

Open the mapobservation + sensor1 191

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 21≤1 km 197≤10 km 270>10 km 22

510 georeferenced · 204 without coordinates

Open the institutions mapphysical evidence714

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions35 of 47 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Philadelphia, US	138
Madison, US	133
Bloomington, US	56
St. Paul, US	40
Chongqing Museumlocation not on record	31
Québec, CA	26
University of New Hampshirelocation not on record	25
Ann Arbor, US	25
Saint John, CA	21
Wuzhou, CN	20
Acadia Universitylocation not on record	19
Burlington, US	17
Toronto, CA	11
Saint Louis, US	11
Université Lavallocation not on record	10
Green Bay, US	10
Davenport, US	9
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	8
Tampa, US	8
New Haven, US	7
College Park, US	7
Philadelphia, US	7
Dekalb, US	6
Bronx, US	6
US	5
Bangkok, TH	4
Hudson, US	3
Millersville, US	3
McWane Science Centerlocation not on record	3
Washington, US	2
Montréal, CA	2
Waverly, US	2
Flagstaff, US	2
Maryland Department of Natural Resourceslocation not on record	1
Museum of the Rockieslocation not on record	1
Trois-Rivières, CA	1
Kingston, US	1
Kirksville, US	1
GB	1
Lincoln, US	1
Royal Ontario Museum, Green Plant Herbarium (TRT)location not on record	1
Universite de Montreal, L'Herbier Marie-Victorinlocation not on record	1
Richmond, US	1
DOI/NPS, Greenbelt Parklocation not on record	1
Boise, US	1
Paris, FR	1
Mohonk Preservelocation not on record	1

47 institutions · 691 of 714 vouchered records shown · 23 without an institution code

09Environmental DNA2 detections

Where the DNA of Geum laciniatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.0 °C 19.0–19.0

Seasonal swing summer↔winter31.4 °C

Max temp (day)23.8 °C

Min temp (night)14.1 °C

Precipitation97.0 mm/mo

Air humidity55.9 %

Moisture balance-48.5 mm/mo

Vapour deficit969 Pa

Wind speed3.60 m/s

Cloud cover45.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Geum laciniatum

At a glance

Sources11 archives

Size & morphology2

Life cycle & reproduction24

Diet & foraging1

Habitat & environment24

Physiology & chemistry19

Uses & economy13

Other traits4

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 906 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions35 of 47 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 906 records