Geum fragarioides

(Michx.) Smedmark · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rosaceae/Geum

At a glance

Occurrence records388

Data sources12

Biological traits17

DNA specimens10

eDNA detections5

Sources12 archives

Databases and archives Geum fragarioides's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility388 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources17 traits

Chemical compositionLOTUS · NPASS2 compounds

Occurrence & distributionGBIF388 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD · NCBI10 specimens

Genome at a glanceCCDB1.3 Gbp

01Narrative

Waldsteinia fragarioides (syn. Dalibarda fragarioides Michx. and Geum fragarioides, also called Appalachian barren strawberry, or just barren strawberry, is a low, spreading plant with showy yellow flowers that appear in early spring. This plant is often used as an underplanting in perennial gardens. In some ways the appearance is similar to other low plants of the rose family such as Fragaria (strawberries) or Potentilla indica (Indian strawberry), but it lacks runners and has more rounded leaves. It is native to eastern North America, from Minnesota, Ontario,Dickinson, T.; Metsger, D.; Bull, J.; & Dickinson, R. (2004). ROM Field Guide to Wildflowers of Ontario, Royal Ontario Museum, Toronto: McClelland and Stewart Ltd., p.343. Quebec, and Maine south to Indiana and Pennsylvania (and as far south as North Carolina in the mountains). It is evergreen.Richardson, Marc and Dan Jaffe (2018). Native Plants for New England Gardens, p.32.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRYGIFT

Size & morphology1

Leaf size1 699 mm²

Life cycle & reproduction4

Deciduousnessevergreen

Flowering endJun

Flowering startMay

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Mycorrhiza typenon-ectomycorrhizal

Woodinessnon-woody

Physiology & chemistry5

Leaf c465 mg/g

Leaf n16.22 mg/g

Leaf p1.54 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)18.18 mm²/mg

03Chemical composition2 compounds

Compounds documented for Geum fragarioides across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Flavonols2

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-3-((2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl)oxychromen-4-one		present	LOTUS
Feruloyl isoquercitrin 4'-glucoside		present	NPASS

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Geum fragarioides has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes7

GenBank sequences7

eDNA detections5

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOL536697.1 ↗332 bpUSA · 2018

ACGT

TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACACGTC …

Geum fragarioides voucher MO:Carlsen3237 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL3★rbcLa★ITS4★ITS2atpF-atpHtrnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Geum fragarioides carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 271 400 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Geum fragarioides1.27 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 42 n = 21

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 421×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Teppner, H. 2003. Erfahrungen mit Ex-situ-Erhaltung im Botanischen Garten des Institutes für Botanik der Universität Graz. Fritschiana 39: 1–22.

n 71×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — TEPPNER, H. 1968. zur Kenntnis der Gattung Waldsteinia. Dissert. Karl-Franzen Univ., Gra2. pp. 1-129.

07Deep time~17.1 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin17.1 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type388 records

Museum / vouchered388

Range

Area of Occupancy AOO1 320 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤100 m 16≤1 km 54≤10 km 175>10 km 19

264 georeferenced · 124 without coordinates

Open the institutions mapphysical evidence388

10Collections & institutions

Holding institutions20 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chongqing Museumlocation not on record	203
Burlington, US	37
Ann Arbor, US	29
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	27
Green Bay, US	21
Madison, US	10
Montréal, CA	8
Chapel Hill, US	7
Saint Louis, US	6
Bloomington, US	5
Whitewater, US	4
College Park, US	4
Norfolk, US	3
Toronto, CA	2
Bangkok, TH	2
St. Paul, US	2
Asheville, US	1
Springfield, US	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
University of Guelph, OAC Herbariumlocation not on record	1
McWane Science Centerlocation not on record	1
Johnson City, US	1
Williamsburg, US	1
Fairfax, US	1
Western Carolina Universitylocation not on record	1
Whitehorse, CA	1

26 institutions · 380 of 388 vouchered records shown · 8 without an institution code

09Environmental DNA5 detections

Where the DNA of Geum fragarioides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.8 °C 18.9–20.6

Seasonal swing summer↔winter26.9 °C

Max temp (day)25.2 °C 24.4–26.0

Min temp (night)15.2 °C 14.3–16.1

Precipitation112 mm/mo 89.0–134

Air humidity56.9 % 56.7–57.2

Moisture balance-41.1 mm/mo -67.7–-14.4

Vapour deficit995 Pa 951–1,040

Wind speed3.30 m/s 3.20–3.40

Cloud cover40.5 % 40.1–40.9

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)