Gesnouinia arborea

(L.fil.) Gaudich. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Urticaceae/Gesnouinia

At a glance

Occurrence records484

Data sources12

Biological traits21

DNA specimens3

eDNA detections3

Sources12 archives

Databases and archives Gesnouinia arborea's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility484 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources21 traits

Occurrence & distributionGBIF484 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB · GoaT499 Mbp

01Narrative

Gesnouinia arborea, (), is a shrub or small tree.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology7

Leaf length max150 mm

Leaf length min30 mm

Leaf width max50 mm

Leaf width min20 mm

Plant height3 m

Plant height max5 m

Plant height min0.5 m

Life cycle & reproduction5

Flower colourgreen

Flowering endJul

Flowering startFeb

Life formshrub or tree

Life spanperennial

Habitat & environment6

Climatesubtropical

Elevation max1 500 m

Elevation min700 m

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: e N

Leaf formlanceolate

Woodinesswoody

Physiology & chemistry1

Specific leaf area (SLA)18.0 mm²/mg

Other traits2

Inflorescencepanicle

Leaf arrangementalternate

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gesnouinia arborea has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences10

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMH341480.1 ↗399 bpSpain · 2011

ACGT

AACGAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAAGTCGTTAGGCT …

Gesnouinia arborea voucher M. Thiv, D. Braun, A. Santos-Guerra 4454, STU 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL4★ITS4★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Gesnouinia arborea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size498 780 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Gesnouinia arborea0.50 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidy2× diploid · measured

Chromosome records20–202n range20median20mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 205×GoaT · Kew Plant DNA C-values Database · CCDB · book-fedorov · CCDB · kew +1

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · book-fedorov — Larsen 1958b, 1960b

CCDB · book-fedorov — LeCoq 1963

CCDB · kew — Suda J, Kyncl T, Freiova R. 2003. Nuclear DNA amounts in Macaronesian angiosperms. Annals of Botany 92: 153-164.

CCDB · Cave1958 — Larsen 1958b

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=0.788 ↗

08Occurrence & distribution

Record type484 records

Wild obs. + sensor446

Museum / vouchered37

Cultivated / captive1

Range

Area of Occupancy AOO1 084 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy26% within 1 km

≤100 m 42≤1 km 71≤10 km 92>10 km 228

433 georeferenced · 13 without coordinates

Open the mapobservation + sensor446

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy93% within 1 km

≤100 m 1≤1 km 12≤10 km 1

14 georeferenced · 23 without coordinates

Open the institutions mapphysical evidence37

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
College of the Atlantic, Museumlocation not on record	4
Barcelona, ES	2
Salamanca, ES	2
Uppsala, SE	2
Madrid, ES	1
Kew, GB	1
Universidad del Pais Vasco (UPV/EHU)location not on record	1
GJOlocation not on record	1
BRNUlocation not on record	1
John May Museum of Natural Historylocation not on record	1
Wlocation not on record	1
Granada, ES	1
Frankfurt am Main	1
Canadian Department of Agriculturelocation not on record	1
Entomological Society of Latvialocation not on record	1
Museo Achille Folettolocation not on record	1
Pamplona, ES	1
BClocation not on record	1
LDlocation not on record	1
South Kensington, GB	1
València, ES	1
Vitoria, ES	1

22 institutions · 28 of 37 vouchered records shown · 9 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Gesnouinia arborea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)