Geropogon hybridus

(L.) Sch.Bip. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Geropogon

At a glance

Occurrence records3 676

Data sources9

Biological traits34

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Geropogon hybridus's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 676 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources34 traits

Occurrence & distributionGBIF3 676 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 14

01Narrative

Several species names have been published in the genus, but only one is recognized. Geropogon hybridus, the pasture goatsbeard or slender salsify, is native to the Mediterranean and adjacent areas, from the Canary Islands to Iran.Flann, C (ed) 2009+ Global Compositae ChecklistThe Plant List, Geropogon hybridus (L.) Sch.Bip.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology12

Fruit length max40 mm

Fruit length min18 mm

Leaf length max230 mm

Leaf length min100 mm

Leaf width max100 mm

Leaf width min30 mm

Plant height0.203 m

Plant height max0.8 m

Plant height min0.15 m

Seed mass14.54 mg

⚠ sources differ — TRY: 14.54 mg · GIFT: 18.08 mg

Seed mass max40.39 mg

Seed mass min10.1 mg

Life cycle & reproduction7

Dehiscenceindehiscent

Flower colourpink

Flowering endJun

Flowering startApr

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max1 000 m

Elevation min0 m

Epiphyteterrestrial

Fruit typeachene

Growth formherb

Habitat GIFTmeadows, mountains, roadsides

Leaf formelliptic

Woodinessnon-woody

Physiology & chemistry2

Leaf n24.37 mg/g

Specific leaf area (SLA)24.59 mm²/mg

Other traits1

Leaf arrangementalternate

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Geropogon hybridus has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences4

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY508213.1 ↗274 bp

ACGT

GAAGGGCGTTCCTCGTATTGCCCCGTTCGCGGTGTGCATGGGGTGTGGCCTCCTGGAAACACAAACGACTCTCGGCAACGGATATCTCGG …

Geropogon hybridus voucher A. Della 1682 (K) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Geropogon hybridus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome records12–142n range14median14mode21records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1418×CCDB · ita-fl · CCDB · iber-fl · CCDB · fl-europaea +4

CCDB · ita-fl — CAPINERI R., D'AMATO G., MARCHI P. - 1976. Numeri cromosomici per la flora italiana:219-231.. Inform. Bot. Ital. , 8(1): 67-74.

CCDB · ita-fl — COLOMBO P., MARCEN C., PRINCIOTTA R. - 1983. Numeros cromosomaticos de plantas occidentales, 200-210.. Anales Jard. Bot. Madrid , 39(2): 519-524.

CCDB · ita-fl — BRULLO S., PAVONE P., TERRASI M.C., ZIZZA A. - 1977 (1976). Numeri cromosomici per la flora italiana:299-314.. Inform. Bot. Ital. , 9(1): 57-71.

CCDB · iber-fl — El gnero Geropogon L. (Compositae, Lactuceae). Daz de la Guardia, C. & G. Blanca.Lazaroa9: 31-44(1988).

CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. II. Compositae, supl. 1 Queirs, M.Bol. Soc. Brot. ser. 247: 299-314(1973).

CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. II. Compositae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 245: 5-121(1971).

CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 720-747. Santa Brbara, C. & al.Lagascalia17(2): 367-379(1994).

CCDB · fl-europaea — Queiros, 1973

CCDB · ipcn-api-dl — Díaz de la Guardia, C. & G. Blanca. 1988. El género Geropogon L. (Compositae, Lactuceae). Lazaroa 9: 31–44.

CCDB · ipcn-api-dl — Wilson, F. D. 1982. A cytological basis for the separation of Geropogon from Tragopogon (Compositae: Lactuceae). Brittonia 34: 290–293.

CCDB · ipcn-api-dl — Brullo, S. & P. PAVONE. 1977. In IOPB chromosome number reports LVII. Taxon 26: 443–452.

CCDB · ipcn-api-dl — Oberprieler, C. & R. Vogt. 1993. Chromosome numbers of north African phanerogams. II. Willdenowia 23: 211–238.

CCDB · ipcn-api-dl — Capineri, R., G. D'Amato & P. MARCHI. 1976. Numeri cromosomici per la flora Italiana: 219-231. Inform. Bot. Ital. 8: 67–74.

CCDB · book-ipcn67-71 — FERNANDES, A., & M. QUEIROS. 1971. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal. II Compositae Bol. soc. Brot. 45 (ser. 2l: 5-122.

CCDB · book-ipcn73-74 — QUEIROS, M. 1973. Contribuicao para o conhecimento citotaxonomico dJ spermatophyta de Portugal. 47(Ser. 2l: 299-314. II Compositae, supl. I Bol. Soc. Brot. I

CCDB · CromoCat 2015 — Díaz de la Guardia, C. & Blanca, G. (1988c). El género Geropogon L. (Compositae, Lactuceae). Lazaroa 9: 31-44.

CCDB · CromoCat 2015 — Wilson, F. D. (1982). A cytological basis for the separation of Geropogon from Tragopogon (Compositae: Lactuceae). Brittonia 34: 290–293.

2n 123×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · CromoCat 2015

CCDB · iber-fl — La posicin sistemtica de Geropogon L. (Compositae) en la subtribu Scorzonerinae Dumort. Daz de la Guardia, C. & G. Blanca.Lagascalia15(Extra): 361-367(1988).

CCDB · ipcn-api-dl — Díaz de la Guardia, C. & G. Blanca. 1988. La posición sistemática de Geropogon L. (Compositae) en la subtribu Scorzonerinae Dumort. Lagascalia 15 (Extra): 361–367.

CCDB · CromoCat 2015 — Díaz de la Guardia, C. & Blanca, G. (1988b). La posición sistemática de Geropogon L. (Compositae) en la subtribu Scorzonerinae Dumort. Lagascalia 15(Extra): 361-367.

n 01×CCDB · CromoCat 2015

CCDB · CromoCat 2015 — Wilson, F. D. (1982). A cytological basis for the separation of Geropogon from Tragopogon (Compositae: Lactuceae). Brittonia 34: 290–293.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type3 676 records

Wild obs. + sensor3 426

Museum / vouchered233

Other17

Origin

Native71

Introduced1

Range

Area of Occupancy AOO7 832 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy53% within 1 km

≤100 m 550≤1 km 227≤10 km 670>10 km 30

1 477 georeferenced · 1 949 without coordinates

Open the mapobservation + sensor3 426

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤100 m 4≤1 km 28≤10 km 41

73 georeferenced · 160 without coordinates

Open the institutions mapphysical evidence233

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BIO-UNIPIlocation not on record	53
LDlocation not on record	45
BClocation not on record	20
Berlin, DE	19
Pullman, US	9
Badajoz, ES	8
CICYTEXlocation not on record	8
MAlocation not on record	7
Jaén, ES	4
Moscow State Universitylocation not on record	3
Granada, ES	3
València, ES	3
Institut und Museum fuer Geologie und Palaeontologielocation not on record	3
UIBlocation not on record	3
Wlocation not on record	3
Provincia di Livornolocation not on record	3
Oskarshamn, SE	3
BRNUlocation not on record	2
Görlitz, DE	2
Bern, CH	1
Frankfurt am Main	1
Córdoba, ES	1
Edinburgh, GB	1
Rishon Le Zion, IL	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Salamanca, ES	1

26 institutions · 208 of 233 vouchered records shown · 25 without an institution code

09Environmental DNA1 detections

Where the DNA of Geropogon hybridus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Geropogon hybridus

At a glance

Sources9 archives

Size & morphology12

Life cycle & reproduction7

Diet & foraging1

Habitat & environment11

Physiology & chemistry2

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type3 676 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 26 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type3 676 records