Gerbera aurantiaca

Sch.Bip. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Gerbera

At a glance

Occurrence records69

Data sources7

Biological traits13

DNA specimens3

eDNA detections2

Sources7 archives

Databases and archives Gerbera aurantiaca's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility69 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources13 traits

Occurrence & distributionGBIF69 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Gerbera aurantiaca, the Hilton daisy, is a long-lived KwaZulu-Natal mistbelt grassland endemic and is a charismatic species because of its spectacular red flowers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Size & morphology3

Plant height max0.4 m

Plant height min0.05 m

Seed mass2.34 mg

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climberself-supporting

Elevation max2 000 m

Elevation min800 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gerbera aurantiaca has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences1

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMG661711.1 ↗578 bp

ACGT

ATTGGGCCTCGGCCCCTGACCAACGACGCTCTGTCGGCAAGCGCTCGTTGTTCACTCTTTGGGTGCGGCGTTTGTCTTGTCGACGCAATA …

Gerbera aurantiaca voucher Bayliss 2505 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcLa★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type69 records

Wild obs. + sensor28

Museum / vouchered41

Range

Area of Occupancy AOO224 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy64% within 1 km

≤100 m 13≤1 km 3≤10 km 2>10 km 7

25 georeferenced · 3 without coordinates

Open the mapobservation + sensor28

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy11% within 1 km

≤1 km 1≤10 km 8

9 georeferenced · 32 without coordinates

Open the institutions mapphysical evidence41

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Durban, ZA	20
Pretoria, ZA	9
Kew, GB	8
South Kensington, GB	1
Buffelskloof Private Nature Reserve, Herbariumlocation not on record	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1

6 institutions · 40 of 41 vouchered records shown · 1 without an institution code

09Environmental DNA2 detections

Where the DNA of Gerbera aurantiaca was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.4 °C 15.4–15.4

Seasonal swing summer↔winter9.60 °C

Max temp (day)21.7 °C

Min temp (night)9.40 °C

Precipitation98.7 mm/mo

Air humidity60.2 %

Moisture balance-24.2 mm/mo

Vapour deficit696 Pa

Wind speed2.70 m/s

Cloud cover24.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)