Geranium palmatum

Cav. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Geraniales/Geraniaceae/Geranium

At a glance

Occurrence records575

Data sources9

Biological traits9

DNA specimens9

eDNA detections5

Sources9 archives

Databases and archives Geranium palmatum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility575 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF575 records

Environmental DNA1 datasets · 0 countries5 detections

DNA & barcodingBOLD · NCBI9 specimens

Genome at a glanceCCDB2n = 68

01Narrative

Geranium palmatum, faussement appelé géranium des Canaries, est une espèce de plante à fleurs de la famille des Géraniacées, originaire de l'île de Madère. C'est une plante vivace formant des rosettes de 1,5 m de hauteur par 1 m de large. Elle possède des feuilles persistantes palmées et des fleurs roses de 4 cm de diamètre. Ce géranium est rustique jusqu'à -10 °C. En culture, cette plante nécessite une situation abritée en plein soleil avec un peu d'ombre l'après-midi. Elle n'aime pas les sols lourds et humides, préférant un milieu léger et bien drainé. L'espèce est sympatrique avec une autre espèce proche, également endémique de Madère : Le bien nommé Géranium de Madère.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formbiennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Geranium palmatum has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes3

GenBank sequences10

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN124889.1 ↗681 bpPortugal

ACGT

AAGGAGAAATCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAACCCTGCACAGCAGAACGACCCGCGAACTCGTAA …

Geranium palmatum voucher Seybold 15068 (STU) 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL4★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Geranium palmatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 68 n = 34

Ploidypolyploid inferred

Chromosome records68–1282n range90median68mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 683×CCDB · ipcn-api-dl · CCDB · book-indian_vol1 · CCDB · book-atlas-flowering-plants

CCDB · ipcn-api-dl — Dalgaard, V. 1991. Chromosome studies in flowering plants from Macaronesia II. Willdenowia 20: 139–152.

CCDB · book-indian_vol1 — Warburg, E.F. 1938a

CCDB · book-atlas-flowering-plants — Warburg 1938

2n 1282×CCDB · book-indian_vol1 · CCDB · book-atlas-flowering-plants

CCDB · book-indian_vol1 — Jackson, W. 1952

CCDB · book-atlas-flowering-plants — Jackson unp,

2n 1121×CCDB · book-indian_vol1

CCDB · book-indian_vol1 — Chatterjee, A. & Sharma, A.K. 1970

n 561×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — CHATERJEE, A., & A.K. SHARMA. 1970. Chromosome study in Geraniales. Nucleus 13: 17 9-200.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type575 records

Wild obs. + sensor533

Museum / vouchered40

Cultivated / captive2

Origin

Introduced24

Range

Area of Occupancy AOO340 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 227≤1 km 99≤10 km 36>10 km 31

393 georeferenced · 140 without coordinates

Open the mapobservation + sensor533

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy88% within 1 km

≤100 m 4≤1 km 3>10 km 1

8 georeferenced · 32 without coordinates

Open the institutions mapphysical evidence40

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	17
Wlocation not on record	3
LDlocation not on record	3
Davis, US	2
MAlocation not on record	2
BClocation not on record	2
Claremont, US	1
Barcelona, ES	1
San Diego Natural History Museum, Herbariumlocation not on record	1
San Diego, US	1
Auckland, NZ	1
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1
Canadian Department of Agriculturelocation not on record	1
Saint Louis, US	1

14 institutions · 37 of 40 vouchered records shown · 3 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA5 detections

Where the DNA of Geranium palmatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)