Geocapromys thoracatus

(True, 1888) · species

image placeholder — illustration coming later

Animalia/Chordata/Mammalia/Rodentia/Capromyidae/Geocapromys

At a glance

Occurrence records13

Data sources7

Biological traits18

DNA specimens3

eDNA detections3

Sources7 archives

Databases and archives Geocapromys thoracatus's data was compiled from.

WikipediaWikimedia Foundation9 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility13 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources18 traits

Occurrence & distributionGBIF13 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD3 specimens

01Narrative

The Little Swan Island hutia (Geocapromys thoracatus) is an extinct species of rodent that lived on Little Swan Island, off northeastern Honduras in the Caribbean. It was a slow-moving, guinea-pig-like rodent and probably emerged from caves and limestone crevices to forage on bark, small twigs and leaves.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPanTHERIAAmnioteDBEltonTraits

Size & morphology3

Body mass1 500 g

Head body length337 mm

SVL37.81 cm

Life cycle & reproduction6

Age at sexual maturity365 days

Gestation120 days

Litter size1.8

Litters per year2 /year

Max. longevity162 months

Weaning age2.17 days

Diet & foraging4

Breadth1

Fruit30 %

Plant other70 %

Trophic levelherbivore

Habitat & environment2

Habitat breadth2

Terrestriality2.00

Other traits3

Activity cycle2.00

Foraging stratumS

Interbirth interval168 days

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Geocapromys thoracatus has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

eDNA detections3

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P738 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

TTTATATTTATTATTTGGTGCTTGAGCTGGAATAGTAGGGACCGCCCTAAGCCTATTAATCCGAGCAGAATTAGGACAACCAGGTACACT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Capromys piloridessame family11.3%Mesocapromys melanurussame family12.3%Proechimys longicaudatussame order15.1%Leopoldamys edwardsisame order16.4%Hoplomys gymnurussame order16.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type13 records

Museum / vouchered13

Range

Area of Occupancy AOO8 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 13

13 georeferenced

Open the institutions mapphysical evidence13

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	11
New Haven, US	2

2 institutions · 13 of 13 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Geocapromys thoracatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.0 °C 19.0–19.0

Seasonal swing summer↔winter3.80 °C

Max temp (day)24.0 °C

Min temp (night)14.2 °C

Precipitation107 mm/mo

Air humidity67.1 %

Moisture balance-13.7 mm/mo

Vapour deficit727 Pa

Wind speed3.30 m/s

Cloud cover27.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)