Gentiana alpina

Vill. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Gentianaceae/Gentiana

At a glance

Occurrence records10 277

Data sources9

Biological traits10

DNA specimens87

eDNA detections87

Sources9 archives

Databases and archives Gentiana alpina's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility10 277 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI87 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics87 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources10 traits

Occurrence & distributionGBIF10 277 records

Environmental DNA1 datasets · 0 countries87 detections

DNA & barcodingBOLD · NCBI87 specimens

Genome at a glanceCCDB2n = 36

01Narrative

La Gentiane des Alpes aussi appelée Gentiane alpine est une espèce de plantes herbacées vivaces de la famille des Gentianaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesLEDAGIFTWCVPTRY

Size & morphology4

Plant height0.05 m

Seed mass0.193 mg

Seed mass max0.2 mg

Seed mass min0.2 mg

Life cycle & reproduction3

Dispersal typeself

Life formperennial

Life spanperennial

Habitat & environment3

Climatetemperate

Growth formherb

Woodinessnon-woody

05DNA & barcoding87 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gentiana alpina has left across the world's sequence archives.

At a glance

DNA specimens87

Marker genes2

GenBank sequences10

eDNA detections87

The DNA barcodea real sequence read deposited for this species

matKKU673877.1 ↗740 bp

ACGT

TTTTTTGCGATTCTTTTTCTACGAATATTGGAATTGGAATAATTTTAGTGTTACAAAGAATCCCAGCCTTGCTCTTTTAACAAAAAGAAA …

Gentiana alpina voucher Gal_5143 maturase K (matK) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK10★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Gentiana alpina carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidypolyploid inferred

Chromosome records36–362n range36median36mode8records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 368×CCDB · iber-fl · CCDB · fl-europaea · CCDB · ipcn-api-dl +5

CCDB · iber-fl — Recherches sur les liens de parent entre la flore orophile des Alpes et celledes Pyrnes. Kpfer, P.Boissiera23: 3-322(1974).

CCDB · fl-europaea — Favarger &

CCDB · ipcn-api-dl — Love, A. & D. Love. 1975c. The Spanish gentians. Anales Inst. Bot. Cavanilles 32: 221–232.

CCDB · book-ipcn75-78 — Love & Love 1975c

CCDB · book-ipcn73-74 — KUPFER, P. 1974. Recherches sur les liens de parente entre la flore orophile des Alpes et celle des Pyrenees. Boissiera 23: 1-322.

CCDB · book-fedorov — Favarger 1949a

CCDB · book-atlas-flowering-plants — Favarger 1949a

CCDB · CromoCat 2015 — Küpfer, P. (1974). Recherches sur les liens de parenté entre la flore orophile des Alpes et celle des Pyrénées. Boissiera 23: 3- 322.

n 182×CCDB · book-ipcn67-71 · CCDB · CromoCat 2015

CCDB · book-ipcn67-71 — FAVARGER, C., & P. KUPFER. 1968. Contribution a la cytotaxinomie de la flore alpine des Pyrenees. Collect. Bot. 7: 325-352.

CCDB · CromoCat 2015 — Favarger, C. & Küpfer, P. (1968). Contribution à la cytotaxonomie de la flore alpine des Pyréneés. Collect. Bot. (Barcelona) 7(1): 325-357.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type10 277 records

Wild obs. + sensor9 767

Museum / vouchered503

Other7

Range

Area of Occupancy AOO6 568 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy40% within 1 km

≤100 m 2 251≤1 km 539≤10 km 4 191>10 km 78

7 059 georeferenced · 2 708 without coordinates

Open the mapobservation + sensor9 767

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 7≤1 km 64≤10 km 111>10 km 7

189 georeferenced · 314 without coordinates

Open the institutions mapphysical evidence503

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	120
Zürich, CH	82
Zürich, CH	49
CJBGlocation not on record	47
Barcelona, ES	41
BDBClocation not on record	21
MAlocation not on record	19
Kunming, CN	15
Universidad del Pais Vasco (UPV/EHU)location not on record	11
LDlocation not on record	7
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	6
College of the Atlantic, Museumlocation not on record	6
València, ES	6
Granada, ES	5
BClocation not on record	4
Institut und Museum fuer Geologie und Palaeontologielocation not on record	4
Bern, CH	4
Christchurch, NZ	4
Vitoria, ES	3
San Sebastián, ES	3
Sion, CH	2
Wlocation not on record	2
Frankfurt am Main	2
Entomological Society of Latvialocation not on record	2
Salamanca, ES	2
Adam Mickiewicz University in Poznańlocation not on record	2
San Jose State University, Museum of Birds and Mammalslocation not on record	1
SNSNMClocation not on record	1
Porrentruy, CH	1
Moscow State Universitylocation not on record	1
Fribourg, CH	1
Lausanne, CH	1
WTUlocation not on record	1
IPE-CSIClocation not on record	1
Coimbra, PT	1
Phyletisches Museum Jenalocation not on record	1

36 institutions · 479 of 503 vouchered records shown · 24 without an institution code

09Environmental DNA87 detections

Where the DNA of Gentiana alpina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found87

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 87 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Gentiana alpina

At a glance

Sources9 archives

Size & morphology4

Life cycle & reproduction3

Habitat & environment3

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type10 277 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions18 of 36 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type10 277 records