Genoplesium apostasioides

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Genoplesium

At a glance

Occurrence records14

Data sources7

Biological traits20

DNA specimens1

eDNA detections1

Sources7 archives

Databases and archives Genoplesium apostasioides's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility14 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources20 traits

Occurrence & distributionGBIF14 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Genoplesium apostasioides, commonly known as the freak midge orchid, is a small terrestrial orchid endemic to New South Wales. It has a single thin leaf fused to the flowering stem and up to fifteen small, yellowish green flowers with a reddish labellum. The flowers do not open widely and are self-pollinating. It grows in heath and shallow moss gardens on rock ledges from the Blue Mountains to Nerriga.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology4

Leaf length225 mm

Plant height0.225 m

Plant height max0.3 m

Plant height min0.15 m

Life cycle & reproduction6

Flowering endApr

Flowering startDec

Flowering timeyyyynnnnnnny

Life formtuberous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Genoplesium apostasioides has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences2

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSKF929432.1 ↗703 bp

ACGT

ATCATTGTCGAGACCGAAAAGAGATCGAGCCATTCTGAAAACCTGTGAACTATCTTCTTGGTGCCGGCAAAAGCTGTCGCCAAGCACTCG …

Genoplesium apostasioides isolate D140 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS2

fungal barcode

08Occurrence & distribution

Record type14 records

Wild obs. + sensor14

Range

Area of Occupancy AOO52 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy57% within 1 km

≤100 m 7≤1 km 1>10 km 6

14 georeferenced

Open the mapobservation + sensor14

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA1 detections

Where the DNA of Genoplesium apostasioides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.