Gennaria griffithii — The Life Data

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Gennaria

At a glance

Occurrence records0

Data sources5

Biological traits9

DNA specimens0

eDNA detections2

Sources5 archives

Databases and archives Gennaria griffithii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingNCBIsequences

01Narrative

Gennaria griffithii is a species of flowering plant in the family Orchidaceae, native from Afghanistan to China. It is a terrestrial species, with a small tuber and small greenish flowers, found in damp places. It has a complicated taxonomic history, having been transferred between genera several times. When placed in a genus on its own it is correctly known as Dithrix griffithii. In 2015, it was transferred to the genus Gennaria.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formtuberous geophyte

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding5 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gennaria griffithii has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences5

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSJN696445.1 ↗709 bp

ACGT

ACCTGCGGAAGGATCATTGTCGAGACCCAAAATAGATCGAGTGATTTGACAACTTGTGAATTATCTTTACAGCTCGCTTTGTGGCTGTAC …

Nujiangia griffithii voucher Jin10879 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK2rbcL2ITS1

plant barcodefungal barcode

09Environmental DNA2 detections

Where the DNA of Gennaria griffithii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.