Genlisea violacea

A.St.-Hil. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Lentibulariaceae/Genlisea

At a glance

Occurrence records123

Data sources7

Biological traits10

DNA specimens14

eDNA detections12

Sources7 archives

Databases and archives Genlisea violacea's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility123 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF123 records

Environmental DNA1 datasets · 0 countries12 detections

DNA & barcodingBOLD · NCBI14 specimens

Genome at a glanceGoaT1 Gbp

01Narrative

Genlisea violacea is a corkscrew plant native to South America.Saint-Hilaire, A. 1833. Voyage dans le District du Diamans du Brésil 2: 428–432.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTCampo de Altitude, Campo Rupestre, Cerrado (lato sensu), Floresta Ciliar ou Galeria

Woodinessnon-woody

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Genlisea violacea has left across the world's sequence archives.

At a glance

DNA specimens14

Marker genes4

GenBank sequences10

eDNA detections12

The DNA barcodea real sequence read deposited for this species

ITSMG027714.1 ↗636 bp

ACGT

CAATCGACCGCGAACTCGTTATCGATGCTCATGAGGTGCGCACGGCGGGCATGCCCTGTTGTCGCCCCTCCCGTCCGTTGGGCGCCGTGT …

Genlisea violacea voucher VFOM1635 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★matK3★rbcL2★ITS5

animal barcodeplant barcodefungal barcode

06Genome at a glanceGoaT

The complete instruction manual Genlisea violacea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 005 384 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Genlisea violacea1.01 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidy2× diploid · measured

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 161×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database — ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

08Occurrence & distribution

Record type123 records

Wild obs. + sensor5

Museum / vouchered118

Origin

Native76

Range

Area of Occupancy AOO304 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 2>10 km 2

4 georeferenced · 1 without coordinates

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 4>10 km 1

5 georeferenced · 113 without coordinates

Open the institutions mapphysical evidence118

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
USP-IBlocation not on record	58
Bronx, US	16
Chicago, US	10
JBRJlocation not on record	9
Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record	5
Laboratorio de Ictiologialocation not on record	3
IPA/SPlocation not on record	3
Kew, GB	3
UFMGlocation not on record	3
UnBlocation not on record	2
San Jose State University, Museum of Birds and Mammalslocation not on record	2
Jena Microbial Resource Collectionlocation not on record	1
UFABClocation not on record	1
Feira de Santana, BR	1
Ural Federal University "B. N. Yeltsin"location not on record	1

15 institutions · 118 of 118 vouchered records shown

09Environmental DNA12 detections

Where the DNA of Genlisea violacea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)