Geitodoris planata

(Alder & Hancock, 1846) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Nudibranchia/Discodorididae/Geitodoris

At a glance

Occurrence records2 099

Data sources8

Biological traits2

DNA specimens23

eDNA detections20

Sources8 archives

Databases and archives Geitodoris planata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 997 records↗

OBISOcean Biodiversity Information System102 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS2 099 records

Environmental DNA1 datasets · 5 countries20 detections

DNA & barcodingBOLD23 specimens

01Narrative

Geitodoris planata is a species of sea slug or dorid nudibranch, a marine gastropod mollusk in the family Discodorididae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Geitodoris planata has left across the world's sequence archives.

At a glance

DNA specimens23

BINs2

Marker genes1

eDNA detections20

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)1.1%

Haplotypes2

BIN1

Most divergent pair1.2%

Where individuals differ — all 16 variable positions, in barcode order

40Cmostly conserved

166Amostly conserved

169Cmostly conserved

226Cmostly conserved

232Tmostly conserved

250Tmostly conserved

304Amostly conserved

355Amostly conserved

370Amostly conserved

406Cmostly conserved

518Cmostly conserved

604Tmostly conserved

607Tmostly conserved

631Amostly conserved

637Gmostly conserved

655Amostly conserved

AACATTATATATCATTTTTGGTATATGATGTGGACTTCTCGGAACTGGGTTAAGTTTATTAATTCGGTTTGAGTTAGGGACAGCTGGTGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Geitodoris heathisame genus14.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 099 records

Wild obs. + sensor1 947

Museum / vouchered138

Other14

Range

Area of Occupancy AOO1 216 km²

Depth

0–200 m sunlit65

200–1000 m twilight2

1–4 km midnight0

>4 km abyssal0

median 11.6 m · max 400 m · 67 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 518≤1 km 82≤10 km 74>10 km 2

676 georeferenced · 1 271 without coordinates

Open the mapobservation + sensor1 947

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy76% within 1 km

≤100 m 20≤1 km 6≤10 km 8

34 georeferenced · 104 without coordinates

Open the institutions mapphysical evidence138

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NTNU-VMlocation not on record	14
Bergen, NO	10
Gothenburg, SE	7
New Haven, US	6
DASSHlocation not on record	3
Museo Nacional de Ciencias Naturales (CSIC)location not on record	2
University of Barcelona, Department of Evolutionary Biology, Ecology and Environmental Scienceslocation not on record	2
PNHSlocation not on record	2
Cambridge, US	1
Paris, FR	1
Philadelphia, US	1
Los Angeles, US	1
South Kensington, GB	1
Goteborg Natural History Museumlocation not on record	1

14 institutions · 52 of 138 vouchered records shown

09Environmental DNA20 detections

Where the DNA of Geitodoris planata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found20

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 20 detections have coordinates

Open the map5 countries0

Mixed bottomRockOn rockOn pillar

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.40 °C 3.90–15.0

Seasonal swing summer↔winter12.8 °C

Max temp (day)11.2 °C 5.00–17.1

Min temp (night)6.30 °C 2.40–12.0

Precipitation73.6 mm/mo 59.3–172

Air humidity62.5 % 60.5–65.1

Moisture balance98.0 mm/mo

Vapour deficit457 Pa 292–622

Wind speed5.10 m/s

Cloud cover51.4 % 40.7–56.9

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Geitodoris planata

At a glance

Sources8 archives

Habitat & environment2

At a glance

Record type2 099 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 14 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 099 records