Gastrolobium polystachyum

Meisn. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Gastrolobium

At a glance

Occurrence records195

Data sources8

Biological traits21

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Gastrolobium polystachyum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility195 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources21 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF195 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 16

01Narrative

Gastrolobium polystachyum là một loài thực vật có hoa trong họ Đậu. Loài này được Meissner miêu tả khoa học đầu tiên.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFT

Size & morphology4

Leaf length20 mm

Leaf width16 mm

Plant height1 m

Plant height max1 m

Life cycle & reproduction6

Flowering timennnnnnyyynnn

Life formsubshrub or shrub

Life spanperennial

Reproductive maturity3 years

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Fruit fleshinessdry

Fruit typelegume

Growth formshrub

Leaf compoundnesssimple

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnitrogen_fixer

Photosynthetic pathwayC3

03Chemical composition1 compounds

Compounds documented for Gastrolobium polystachyum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Fluoroacetic acid		present	LOTUS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gastrolobium polystachyum has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

matKAF298459.1 ↗903 bp

ACGT

CACATTTCTATGAAACAATTGGTTCATCCATACCACCGGTAGAGTTTGTAAGACCACGACTGATCCAGAAAGGAATGAATGGAAAAAACA …

Gastrolobium polystachyum trnK gene, intron, 5' partial sequence; and maturase K (matK) gene, partial cds; chloroplast genes for chloroplast products

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Gastrolobium polystachyum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 163×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78

CCDB · ipcn-api-dl — SANDS, V. E. 1975. The cytoevolution of the Australian Papilionaceae. Proc. Linn. Soc. New South Wales 100: 118–155.

CCDB · book-ipcn75-78 — Sands 197 5

CCDB · book-ipcn75-78 — Sands 1975

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type195 records

Wild obs. + sensor51

Museum / vouchered144

Origin

Native7

Range

Area of Occupancy AOO420 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 19≤1 km 8≤10 km 7>10 km 2

36 georeferenced · 15 without coordinates

Open the mapobservation + sensor51

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 32≤1 km 12≤10 km 64>10 km 8

116 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence144

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	69
Canberra, AU	32
Brisbane, AU	9
Museo Entomologico de Leonlocation not on record	9
Adelaide, AU	8
Mount Annan, AU	7
BGPAlocation not on record	3
Paris, FR	2
Armidale, AU	2
Hobart, AU	1
LDlocation not on record	1
Palmerston, AU	1

12 institutions · 144 of 144 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)