Gastrodes abietum

Bergroth, 1914 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Rhyparochromidae/Gastrodes

At a glance

Occurrence records3 575

Data sources8

Biological traits2

DNA specimens23

eDNA detections125

Sources8 archives

Databases and archives Gastrodes abietum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 575 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI125 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF3 575 records

Environmental DNA4 datasets · 5 countries125 detections

DNA & barcodingBOLD23 specimens

01Narrative

Gastrodes abietum, the spruce cone bug, is a species of dirt-colored seed bug in the family Rhyparochromidae. It is found in the Palearctic. Gastrodes abietum, spruce cone bug

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)herbivore

Feeding guild (larval)herbivore

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gastrodes abietum has left across the world's sequence archives.

At a glance

DNA specimens23

BINs1

Marker genes1

eDNA detections125

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

88Amostly conserved

97Tmostly conserved

169Gmostly conserved

316Gmostly conserved

407Tmostly conserved

529Tmostly conserved

622Gmostly conserved

TACCCTTTACTTTATATTTGGAATATGATCAGGTATAGTAGGATCATCACTAAGATGAATCATTCGAATTGAATTAGGACAACCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.23%

Haplotypes8

BIN1

Most divergent pair0.61%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Eremocoris plebejussame family12.6%Gastrodes grossipessame genus13.1%Eremocoris ferussame family14.2%Eremocoris abietissame family14.3%Drymus crassussame family14.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 575 records

Wild obs. + sensor3 147

Museum / vouchered351

Other77

Range

Area of Occupancy AOO9 856 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 1 492≤1 km 625≤10 km 430>10 km 64

2 611 georeferenced · 536 without coordinates

Open the mapobservation + sensor3 147

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy81% within 1 km

≤100 m 137≤1 km 111≤10 km 56>10 km 1

305 georeferenced · 46 without coordinates

Open the institutions mapphysical evidence351

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	96
SLU Artdatabankenlocation not on record	35
Jyväskylä, FI	22
Provincia di Livornolocation not on record	16
Philadelphia, US	11
Tartu, EE	10
Bonn, DE	10
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	8
Metsähallituslocation not on record	7
ZMAAlocation not on record	6
ZSMlocation not on record	5
neflocation not on record	4
Adam Mickiewicz University in Poznańlocation not on record	4
Helsinki, FI	3
Tromsø, NO	2
NTNU-VMlocation not on record	2
BioFokuslocation not on record	2
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	2
CBDClocation not on record	2
NCMGlocation not on record	2
Tallinn, EE	1
Forssa, FI	1

22 institutions · 251 of 351 vouchered records shown · 100 without an institution code

09Environmental DNA125 detections

Where the DNA of Gastrodes abietum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found125

Studies independent surveys4

Countries5

Verifiable raw sequence linked107

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 125 detections have coordinates

Open the map5 countries0

Urban

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.40 °C 0.2–14.5

Seasonal swing summer↔winter18.9 °C

Max temp (day)9.90 °C 2.70–18.6

Min temp (night)5.60 °C -2.60–11.6

Precipitation55.4 mm/mo 34.4–77.1

Air humidity62.0 % 58.4–67.2

Moisture balance-4.80 mm/mo -58.4–35.3

Vapour deficit438 Pa 212–685

Wind speed3.30 m/s 2.60–4.60

Cloud cover48.6 % 43.0–57.9

CHELSA 1981–2010, ~9 km grid, at location & month of 125 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Gastrodes abietum

At a glance

Sources8 archives

Diet & foraging2

At a glance

Record type3 575 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 22 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 575 records