Gasterophilus intestinalis

(De Geer, 1776) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Oestridae/Gasterophilus

At a glance

Occurrence records499

Data sources8

Biological traits0

DNA specimens86

eDNA detections86

Sources8 archives

Databases and archives Gasterophilus intestinalis's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

Animal Diversity WebUniv. of Michigan MZspecies account↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility499 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI86 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics86 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeADW · Wikipediaarticle

Occurrence & distributionGBIF499 records

Environmental DNA1 datasets · 4 countries86 detections

DNA & barcodingBOLD86 specimens

01Narrative

Gasterophilus intestinalis, also known as horse bot fly, is a species of insect of the family Oestridae, and is found worldwide. The adults, which have a bumblebee-like appearance, are prominently active in the summer. G. intestinalis is primarily a parasite of horses, mules and donkeys.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding86 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gasterophilus intestinalis has left across the world's sequence archives.

At a glance

DNA specimens86

BINs2

Marker genes2

eDNA detections86

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P643 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

6Gmostly conserved

60Avariable

64Cmostly conserved

243Amostly conserved

462Tmostly conserved

471Tmostly conserved

489Gmostly conserved

522Tmostly conserved

CATAAGGATATTGGTACACTTTATTTCATTTTCGGTGCTTGATCTGGACTAATTGGAACATCTCTAAGAGTCCTAATTCGAGCAGAACTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.96%

Haplotypes15

BINs2

Most divergent pair5.3%

AsiaAfricaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Gasterophilus nigricornissame genus15.4%Melieria crassipennissame order15.6%Scipopus diversussame order15.7%Scipopus calocephalussame order16.1%Blera eoasame order16.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_029834 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND116S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type499 records

Wild obs. + sensor244

Museum / vouchered255

Range

Area of Occupancy AOO1 192 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 125≤1 km 33≤10 km 68>10 km 2

228 georeferenced · 16 without coordinates

Open the mapobservation + sensor244

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy30% within 1 km

≤100 m 6≤1 km 27≤10 km 73>10 km 5

111 georeferenced · 144 without coordinates

Open the institutions mapphysical evidence255

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
OSUClocation not on record	34
Helsinki, FI	31
South Kensington, GB	19
Vancouver, CA	17
KwaZulu-Natal Museumlocation not on record	17
Champaign, US	15
East Lansing, US	14
Sydney, AU	6
MZLUlocation not on record	5
Kuopio, FI	5
Washington, US	5
Auckland, NZ	4
CBDClocation not on record	3
Gothenburg, SE	3
Chicago, US	2
NHMOlocation not on record	2
Tilburg, NL	2
Tasmanian Museum & Art Gallerylocation not on record	2
University of Tokyo, Department of Zoologylocation not on record	2
Tartu, EE	2
Cleveland Museum of Natural History, OH (CLEV)location not on record	1
CUlocation not on record	1
San Francisco, US	1
ZMAAlocation not on record	1
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
Cape Town, ZA	1
SLU Artdatabankenlocation not on record	1
DPIlocation not on record	1

28 institutions · 198 of 255 vouchered records shown · 2 without an institution code

09Environmental DNA86 detections

Where the DNA of Gasterophilus intestinalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found86

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 86 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.0 °C 8.70–10.0

Seasonal swing summer↔winter31.5 °C

Max temp (day)15.7 °C 12.3–15.7

Min temp (night)3.10 °C 3.10–5.00

Precipitation13.8 mm/mo 13.8–45.1

Air humidity45.7 % 45.7–62.8

Moisture balance-95.2 mm/mo -95.2–-26.0

Vapour deficit827 Pa 487–827

Wind speed4.50 m/s 4.50–4.60

Cloud cover24.1 % 24.1–42.0

CHELSA 1981–2010, ~9 km grid, at location & month of 76 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)