Gasteria disticha

(L.) Haw. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Asphodelaceae/Gasteria

At a glance

Occurrence records79

Data sources11

Biological traits14

DNA specimens4

eDNA detections1

Sources11 archives

Databases and archives Gasteria disticha's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility79 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Occurrence & distributionGBIF79 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB · GoaT17.5 Gbp

01Narrative

Gasteria disticha is succulent plant native to the Western Cape, South Africa.Gasteria disticha - Information page

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max0.18 m

Plant height min0.02 m

Life cycle & reproduction3

Life formsucculent perennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max800 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gasteria disticha has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes5

GenBank sequences6

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSJQ025278.1 ↗426 bp

ACGT

ATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCCGAAAGGACGACCGCGAA …

Gasteria disticha voucher OM2778 internal transcribed spacer 1, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★rbcLa★ITS2trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB · GoaT

The complete instruction manual Gasteria disticha carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size17 457 300 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

THIS GENOME Gasteria disticha17.46 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidy2× diploid · measured

Chromosome records14–282n range14median14mode18records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1417×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +4

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Vosa, C. G. & S. T. Bennett. 1990. Chromosome studies in the southern African flora. 58--94. Chromosome evolution in the genus Gasteria Duval. Caryologia 43: 235–247.

CCDB · book-ipcn67-71 — RILEY, H.P., R.E. HAMMACK, & S.K. MAJUMDAR. 1968. Chromosome morphology in Gasteria species and hybrids. Nucleus 11: 130-140.

CCDB · book-ipcn67-71 — BRANDHAM, P.E. 1969. Chromosome behavior in the Aloineae. I. The nature and signigicance of E-type bridges Chromosoma 27: 201-215.

CCDB · book-fedorov — Snoad 1951

CCDB · book-fedorov — Geitler 1935b

CCDB · book-fedorov — Riley H. P. 1959c

CCDB · book-fedorov — Marshak 1934

CCDB · book-fedorov — Resende 1937a

CCDB · book-fedorov — Riley H. P. 19~5, 1959c

CCDB · kew — Zonneveld BJM, van Jaarsveld EJ. 2005. Taxonomic implications of genome size for all species of the genus Gasteria Duval (Aloaceae). Plant Systematics and Evolution 251: 217-227.

CCDB · Oberlander2016 — Vosa & Bennett, 1990

CCDB · Cave1959 — Riley 19590

2n 281×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl

n 72×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — BRANDHAM, P.E. 1971. Chromosomes of the Liliaceae II, Polyploidy and karyotype variation in the Aloineae. Kew Bull. 25: 381-399.

n 141×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — BRANDHAM, P.E. 1971. Chromosomes of the Liliaceae II, Polyploidy and karyotype variation in the Aloineae. Kew Bull. 25: 381-399.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type79 records

Wild obs. + sensor75

Museum / vouchered4

Range

Area of Occupancy AOO188 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 50≤1 km 6≤10 km 1>10 km 6

63 georeferenced · 12 without coordinates

Open the mapobservation + sensor75

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the institutions mapphysical evidence4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cape Town, ZA	2
Durban, ZA	1
University of Johannesburglocation not on record	1

3 institutions · 4 of 4 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Gasteria disticha was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.2 °C 14.2–14.2

Seasonal swing summer↔winter7.50 °C

Max temp (day)17.1 °C

Min temp (night)11.4 °C

Precipitation66.2 mm/mo

Air humidity60.5 %

Moisture balance-28.8 mm/mo

Vapour deficit641 Pa

Wind speed3.00 m/s

Cloud cover13.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)