Gasteria carinata

(Mill.) Duval · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Asphodelaceae/Gasteria

At a glance

Occurrence records83

Data sources9

Biological traits21

DNA specimens2

eDNA detections3

Sources9 archives

Databases and archives Gasteria carinata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility83 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources21 traits

Occurrence & distributionGBIF83 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 14

01Narrative

Gasteria brodawkowata, jęzorka brodawkowata, aloesik brodawkowaty – odmiana gatunku G. carinata z rodziny złotogłowowatych (Asphodelaceae). Pochodzi z Południowej Afryki. Roślina ozdobna. Roślina o krótkiej i przyziemnej łodydze. Liście dość grube, soczyste i wydłużone w kolorze ciemnozielonym. Zakończone są ostrym szpicem. Liść pokryty jest białymi brodawkami ułożonymi dwustronnie. Łodyga kwiatowa wyrasta do 60 cm wysokości z gronem zwisających czerwonych kwiatów.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Plant height max0.2 m

Plant height min0.02 m

Seed mass0.82 mg

Seed mass max0.82 mg

Seed mass min0.82 mg

Life cycle & reproduction4

Deciduousnessevergreen

Life formsucculent perennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 000 m

Elevation min0 m

Epiphyteterrestrial

Growth formherb

Mycorrhiza typePh.th.end.

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayCAM

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gasteria carinata has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes4

GenBank sequences10

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOR392236.1 ↗299 bp

ACGT

TCGAGACCCGAAGGACGACCGCGAACCATTGATCTCTTCACAACGAGCGCCCGAGCGTAGCAACGGCGCCGACGCCTATCGCCCCGATAT …

Gasteria carinata voucher Muasya & Zhigila 7903 internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL2★rbcLa★ITS4

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Gasteria carinata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome records14–142n range14median14mode27records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1427×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-fedorov +4

CCDB · ipcn-api-dl — Vosa, C. G. & S. T. Bennett. 1990. Chromosome studies in the southern African flora. 58--94. Chromosome evolution in the genus Gasteria Duval. Caryologia 43: 235–247.

CCDB · book-ipcn67-71 — BRANDHAM, P.E. 1969. Chromosome behavior in the Aloineae. I. The nature and signigicance of E-type bridges Chromosoma 27: 201-215.

CCDB · book-ipcn67-71 — RILEY, H.P., R.E. HAMMACK, & S.K. MAJUMDAR. 1968. Chromosome morphology in Gasteria species and hybrids. Nucleus 11: 130-140.

CCDB · book-fedorov — Marshak 1934

CCDB · book-fedorov — Resende 1937a

CCDB · book-fedorov — Sato D. 1937a, 1942

CCDB · book-fedorov — Snoad 1951

CCDB · book-fedorov — Riley H. P. 1959c

CCDB · book-fedorov — Riley H. P. 1959b

CCDB · book-fedorov — Riley H. P. 1945, 1959c carso

CCDB · book-atlas-flowering-plants — Resende 1937

CCDB · kew — Zonneveld BJM, van Jaarsveld EJ. 2005. Taxonomic implications of genome size for all species of the genus Gasteria Duval (Aloaceae). Plant Systematics and Evolution 251: 217-227.

CCDB · Oberlander2016 — Vosa & Bennett, 1990

CCDB · Cave1959 — Riley 19590

CCDB · Cave1959 — Riley 1959d

CCDB · Cave1959 — Riley 1959c

n 75×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — BRANDHAM, P.E. 1971. Chromosomes of the Liliaceae II, Polyploidy and karyotype variation in the Aloineae. Kew Bull. 25: 381-399.

n 141×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — BRANDHAM, P.E. 1971. Chromosomes of the Liliaceae II, Polyploidy and karyotype variation in the Aloineae. Kew Bull. 25: 381-399.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type83 records

Wild obs. + sensor70

Museum / vouchered9

Cultivated / captive2

Other2

Range

Area of Occupancy AOO228 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 24≤1 km 10≤10 km 1>10 km 13

48 georeferenced · 22 without coordinates

Open the mapobservation + sensor70

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence9

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	5
BDBClocation not on record	2
Phoenix, US	1
University of Johannesburglocation not on record	1

4 institutions · 9 of 9 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Gasteria carinata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.2 °C 10.9–18.2

Seasonal swing summer↔winter7.50 °C

Max temp (day)17.1 °C 15.8–21.5

Min temp (night)11.4 °C 5.70–15.3

Precipitation66.2 mm/mo 31.6–123

Air humidity60.5 % 57.0–60.6

Moisture balance-28.8 mm/mo -89.6–18.6

Vapour deficit641 Pa 563–827

Wind speed3.20 m/s 3.00–7.40

Cloud cover12.2 % 10.9–13.3

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)