Garrya buxifolia

A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Garryales/Garryaceae/Garrya

At a glance

Occurrence records427

Data sources8

Biological traits12

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Garrya buxifolia's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility427 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF427 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Garrya buxifolia is a species of flowering shrub, known by the common names dwarf silktassel and boxleaf silktassel, in the genus Garrya. It is native to Oregon and northern California, where it grows in forests and chaparral, especially in the coastal mountains and hills.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction4

Deciduousnessevergreen

Life formshrub

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Garrya buxifolia has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences3

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSJN234734.1 ↗622 bpUSA

ACGT

TCGAACCTACAAAGCAAACCGCGAACCTATCGAATAACACATCGAGTGAGGCACGGGGGGGTCGCGTTCGGTGCTCCTCCCCTGCCCCAC …

Garrya buxifolia voucher D.O. Burge 1160 (DUKE, in process) internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type427 records

Wild obs. + sensor90

Museum / vouchered336

Fossil1

Range

Area of Occupancy AOO840 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 58≤1 km 5≤10 km 1>10 km 6

70 georeferenced · 20 without coordinates

Open the mapobservation + sensor90

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy57% within 1 km

≤100 m 11≤1 km 70≤10 km 57>10 km 3

141 georeferenced · 195 without coordinates

Open the institutions mapphysical evidence336

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Angwin, US	130
Arcata, US	82
Corvallis, US	21
Claremont, US	18
US	8
Pullman, US	7
Davis, US	6
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	3
San Diego, US	2
Ashland, US	2
Los Angeles, US	2
San Luis Obispo, US	2
WTUlocation not on record	2
MeiseBGlocation not on record	2
New Haven, US	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Moscow, US	1
Paris, FR	1
CASlocation not on record	1
Mexico City, MX	1
KNFYlocation not on record	1
Tacoma, US	1
ASUlocation not on record	1
Bloomington, US	1

24 institutions · 297 of 336 vouchered records shown · 38 without an institution code

09Environmental DNA1 detections

Where the DNA of Garrya buxifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.5 °C 12.5–12.5

Seasonal swing summer↔winter27.0 °C

Max temp (day)18.4 °C

Min temp (night)8.20 °C

Precipitation79.6 mm/mo

Air humidity57.3 %

Moisture balance-38.4 mm/mo

Vapour deficit733 Pa

Wind speed5.80 m/s

Cloud cover36.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)