Garnieria spathulifolia

(Brongn. & Gris) Brongn. & Gris · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Proteales/Proteaceae/Garnieria

At a glance

Occurrence records12

Data sources8

Biological traits7

DNA specimens5

eDNA detections5

Sources8 archives

Databases and archives Garnieria spathulifolia's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility12 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources7 traits

Occurrence & distributionGBIF12 records

Environmental DNA1 datasets · 0 countries5 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

Garnieria is a monotypic plant genus in the family Proteaceae. Molecular hylogenetic studies indicate that it is nested in the larger Australian genus Persoonia where it may be included.Holmes, G. D., Weston, P. H., Murphy, D. J., Connelly, C., & Cantrill, D. J. (2018). The genealogy of geebungs: phylogenetic analysis of Persoonia (Proteaceae) and related genera in subfamily Persoonioideae. Australian Systematic Botany, 31(2), 166-189. It is endemic to New Caledonia where the type specimen was collected at Prony Bay in 1868–1870 by Benjamin Balansa. The only species is Garnieria spathulifolia.Virot, R. (1967). Protéacées. In Flore de La Nouvelle-Calédonie et Dépendances, edited by A. Aubréville, 2:1–254. Paris: Muséum National d’Histoire Naturelle.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRYGIFT

Life cycle & reproduction2

Deciduousnessevergreen

Life spanperennial

Habitat & environment3

Growth formtree

Habitat GIFTrain forest, maquis (scrubland)

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Garnieria spathulifolia has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes3

GenBank sequences6

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOP942404.1 ↗566 bpNew Caledonia

ACGT

CCGCGAACATGTTGCACCATGAGCAGGGGTTGGGGCTTTGGGACGTGAATTCCTTCTCTCCACCCCCTAAAGTCTGTGTCCACGATTCTT …

Persoonia spathulifolia voucher Pillon 1505 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS4

plant barcodefungal barcode

08Occurrence & distribution

Record type12 records

Wild obs. + sensor2

Museum / vouchered10

Range

Area of Occupancy AOO40 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 10 records without

Open the institutions mapphysical evidence10

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	4
Paris, FR	1
Stockholm, SE	1
Kew, GB	1
JBRJlocation not on record	1
Monastir, TN	1
South Kensington, GB	1

7 institutions · 10 of 10 vouchered records shown

09Environmental DNA5 detections

Where the DNA of Garnieria spathulifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)