Gardenia tubifera

Wall. ex Roxb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Rubiaceae/Gardenia

At a glance

Occurrence records59

Data sources10

Biological traits17

DNA specimens7

eDNA detections4

Sources10 archives

Databases and archives Gardenia tubifera's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility59 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources17 traits

Chemical compositionLOTUS · NPASS143 compounds

Occurrence & distributionGBIF59 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Mentiung, turut disebut kopeng air, cempaka tanjung, cempaka utan, delima hutan, jambu batu hutan, pekan heran atau kepayang ipil ialah spesies pokok kecil berbunga dalam genus Gardenia yang tempatan dari Asia. Ia pokok kecil yang tumbuh mencapai ketinggian 2–4 m (6–12 ka) tinggi dengan capahan 1–2 m (3–6 ka). Ia gemar akan persekitaran tropika dan tidak tahan iklim sederhana di bawah beku.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height max25 m

Life cycle & reproduction4

Deciduousnessevergreen

Life formshrub

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: T

Woodinesswoody

Physiology & chemistry6

Leaf C:N ratio32.53 g/g

Leaf c465 mg/g

Leaf n14.29 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)15.2 mm²/mg

Wood density670 mg/cm³

03Chemical composition143 compounds

Compounds documented for Gardenia tubifera across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Flavones20

Cinnamic acids and derivatives18

Cycloartane triterpenoids14

Menthane monoterpenoids $ Monocyclic monoterpenoids8

Acyclic monoterpenoids8

Documented compounds143 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Menthol	present	NPASS
(+)-Perillyl alcohol	present	NPASS
(+)-Ursolic Acid	present	NPASS
(-)-alpha-Pinene	present	NPASS
(-)-Camphene	present	NPASS
(-)-Caryophyllene	present	NPASS
(-)-Linalool	present	NPASS
(-)-Menthol	present	NPASS
(1S,3R,10R,13S,14S,17R,18R)-14,18-dimethyl-17-[(2R)-6-methylhept-5-en-2-yl]-9-methylidene-7-oxapentacyclo[11.7.0.01,3.03,10.014,18]icosan-6-one	present	LOTUS
(2E)-1-(3-Furanyl)-4-methyl-2-penten-1-one	present	NPASS

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gardenia tubifera has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes2

GenBank sequences6

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLJX459574.1 ↗325 bp

ACGT

ACCGATGGGCTTACCAGCCTTGATCGTTACAAGGGTCGATGCTATCACATCGAGCCAGTTCCTGGAGAAGAAGATCAATTTATTGCTTAT …

Gardenia tubifera voucher A. Chaveerach 816 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL3

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Gardenia tubifera carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–222n range22median22mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 222×CCDB · book-indian_vol1 · CCDB · book-fedorov

CCDB · book-indian_vol1 — Bhattacharyya, N.K. 1959

CCDB · book-fedorov — Bhattacharyya N. K.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type59 records

Wild obs. + sensor32

Museum / vouchered27

Range

Area of Occupancy AOO148 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 6≤1 km 20≤10 km 2>10 km 1

29 georeferenced · 3 without coordinates

Open the mapobservation + sensor32

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 1≤10 km 1>10 km 1

3 georeferenced · 24 without coordinates

Open the institutions mapphysical evidence27

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	11
Cibinong Science Center, Herbarium Bogorienselocation not on record	5
BISHlocation not on record	4
Columbia, US	2
EL PASO, US	1
Auckland, NZ	1
Fort Worth, US	1

7 institutions · 25 of 27 vouchered records shown · 2 without an institution code

09Environmental DNA4 detections

Where the DNA of Gardenia tubifera was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.1 °C 26.1–26.1

Seasonal swing summer↔winter1.10 °C

Max temp (day)29.5 °C

Min temp (night)22.6 °C

Precipitation269 mm/mo

Air humidity68.1 %

Moisture balance133 mm/mo

Vapour deficit1,080 Pa

Wind speed1.20 m/s

Cloud cover57.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)