Gardenia ovularis

F.M.Bailey · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Rubiaceae/Gardenia

At a glance

Occurrence records277

Data sources7

Biological traits31

DNA specimens7

eDNA detections4

Sources7 archives

Databases and archives Gardenia ovularis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility277 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources31 traits

Occurrence & distributionGBIF277 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI7 specimens

01Narrative

Gardenia ovularis is a species of plant in the family Rubiaceae native to northeastern Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology12

Fruit length30 mm

Fruit width29 mm

Leaf length155 mm

Leaf mass per area81.58 g/m2

Leaf size4 960 mm²

Leaf width55 mm

Plant height20 m

Seed length2 mm

Seed mass1 mg

Seed mass max1 mg

Seed mass min1 mg

Seed width2 mm

Life cycle & reproduction6

Deciduousnessevergreen

Flowering timennnnnnyyyynn

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment8

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typeberry

Growth formtree

Leaf compoundnesssimple

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density732 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gardenia ovularis has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes4

GenBank sequences1

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKF496827.1 ↗552 bpAustralia · 2013

ACGT

AGTGTTGGATTCAAAGCTGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGCA …

Gardenia ovularis isolate BATT120-10 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL1★rbcLatrnH-psbA

plant barcodemarker

08Occurrence & distribution

Record type277 records

Wild obs. + sensor25

Museum / vouchered235

Cultivated / captive1

Other16

Origin

Native6

Range

Area of Occupancy AOO448 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 8≤1 km 3≤10 km 2

13 georeferenced · 12 without coordinates

Open the mapobservation + sensor25

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy39% within 1 km

≤100 m 28≤1 km 26≤10 km 68>10 km 18

140 georeferenced · 95 without coordinates

Open the institutions mapphysical evidence235

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Smithfield, AU	89
Brisbane, AU	55
Museo Entomologico de Leonlocation not on record	18
Kew, GB	11
Canberra, AU	10
John T. Waterhouse Herbariumlocation not on record	9
Palmerston, AU	8
Mount Annan, AU	5
James Cook Townsvillelocation not on record	3
Adelaide, AU	3
Honolulu, US	3
Australian Tropical Herbariumlocation not on record	2
CSIRO, Tropical Forest Research Centrelocation not on record	1
Parkville, AU	1
ASUlocation not on record	1

15 institutions · 219 of 235 vouchered records shown · 15 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Gardenia ovularis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.4 °C 18.7–26.2

Seasonal swing summer↔winter7.30 °C

Max temp (day)28.0 °C 23.3–28.4

Min temp (night)18.2 °C 14.1–24.3

Precipitation123 mm/mo 46.4–228

Air humidity65.4 % 49.9–67.1

Moisture balance-13.5 mm/mo

Vapour deficit1,153 Pa 771–1,505

Wind speed2.70 m/s

Cloud cover33.0 % 22.1–46.8

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)