Gardenia mannii — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Rubiaceae/Gardenia

At a glance

Occurrence records17

Data sources8

Biological traits10

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Gardenia mannii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility17 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF17 records

DNA & barcodingNCBIsequences

01Narrative

Gardenia mannii, the nānū, Oahu gardenia or Mann's gardenia, is a species of flowering tree in the coffee family, Rubiaceae, that is endemic to the island of Oahu in Hawaii. It inhabits coastal mesic, mixed mesic, and wet forests at elevations of 100 – in the Koolau and Waianae Ranges. It is threatened by habitat loss. There are 18 populations remaining with a total of no more than 110 individuals.USFWS. Gardenia mannii Five-year Review. January 2008.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gardenia mannii has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

matKKJ815826.1 ↗2 473 bp

ACGT

GTGCGGCTAGCATCTTTTACACATTTAGATGAAGCAGAGGATTCATCTATACCATCGGTAAAGTTTGGAAGACCACGACTGATCCTGAAA …

Gardenia mannii voucher Takeuchi s.n. 24.8.1985 (GB) maturase K (matK) gene, complete cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1

plant barcode

08Occurrence & distribution

Record type17 records

Museum / vouchered16

Other1

Range

Area of Occupancy AOO40 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤1 km 2≤10 km 1

3 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence16

10Collections & institutions

Holding institutions4 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wellington, NZ	6
BISHlocation not on record	4
Honolulu, US	3
Claremont, US	2
Vancouver, CA	1

5 institutions · 16 of 16 vouchered records shown