Gardenia latifolia

Aiton · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Rubiaceae/Gardenia

At a glance

Occurrence records48

Data sources11

Biological traits13

DNA specimens2

eDNA detections2

Sources11 archives

Databases and archives Gardenia latifolia's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility48 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Chemical compositionLOTUS · NPASS14 compounds

Occurrence & distributionGBIF48 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 22

01Narrative

غردينية عريضة الأوراق هي نوع من النباتات يتبع جنس غردينية من الفصيلة الفوية.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction3

Deciduousnessdeciduous

Life formshrub or tree

Life spanperennial

Habitat & environment3

Climateseasonally dry tropical

Growth formtree

Woodinesswoody

Physiology & chemistry7

Leaf C:N ratio26.77 g/g

Leaf c450 mg/g

Leaf n17 mg/g

Leaf p1.12 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)11.39 mm²/mg

Wood density650 mg/cm³

03Chemical composition14 compounds

Compounds documented for Gardenia latifolia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Oleanane triterpenoids10

Oleanane triterpenoids $ Ursane and Taraxastane triterpenoids1

Anthocyanidins1

Ursane and Taraxastane triterpenoids1

Documented compounds14 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,4aR,6aR,6aS,6bR,8aS,10S,12aR,14bS)-1,10-dihydroxy-2,2,6a,6b,9,9,12a-heptamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid	present	LOTUS
(1S,4aR,6aR,6aS,6bR,8aR,10R,12aR,14bR)-1,10-dihydroxy-2,2,6a,6b,9,9,12a-heptamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid	present	LOTUS
Cyanidin	present	NPASS
LDTDRTSKWGQBAA-ZVCFODLXSA-N	present	NPASS
methyl (1R,4aR,6aR,6aS,6bR,8aR,10S,12aR,14bS)-1,10-diacetyloxy-2,2,6a,6b,9,9,12a-heptamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylate	present	LOTUS
methyl (1R,4aR,6aS,6aS,6bR,8aS,10S,12aR,14bS)-1,10-dihydroxy-2,2,6a,6b,9,9,12a-heptamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylate	present	LOTUS
methyl (1R,4aR,6aS,6aS,6bR,8aS,10S,12aR,14bS)-10-acetyloxy-1-hydroxy-2,2,6a,6b,9,9,12a-heptamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylate	present	LOTUS
methyl (1S,4aR,6aS,6aS,6bR,8aR,10R,12aR,14bS)-1,10-dihydroxy-2,2,6a,6b,9,9,12a-heptamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylate	present	LOTUS
methyl (1S,4aR,6aS,6aS,6bR,8aR,10R,12aR,14bS)-10-acetyloxy-1-hydroxy-2,2,6a,6b,9,9,12a-heptamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylate	present	LOTUS
methyl (4aR,6aS,6aS,6bR,8aR,10S,12aR,14bS)-10-acetyloxy-2,2,6a,6b,9,9,12a-heptamethyl-1-oxo-4,5,6,6a,7,8,8a,10,11,12,13,14b-dodecahydro-3H-picene-4a-carboxylate	present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gardenia latifolia has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences6

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLMN216549.1 ↗560 bpTanzania

ACGT

AGACTAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATA …

Gardenia latifolia voucher CP326 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL4

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Gardenia latifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 221×CCDB · book-indian_vol1

CCDB · book-indian_vol1 — Bir, S.S., Gill, B.S. & Bedi, Y.S. 1979 ~ Sanjappa, M. & Sathyananda, N. 1979

n 114×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Gill, B. S., V. K. Singhal, Y. S. Bedi & S. S. Bir. 1990. Cytological evolution in the woody taxa of Pachmarhi Hills. J. Cytol. Genet. 25: 308–320.

CCDB · ipcn-api-dl — Bedi, Y. S., S. S. Bir & B. S. Gill. 1981a. Cytopalynology of woody taxa of family Rubiaceae from north and central India. Proc. Indian Acad. Sci., B 47: 708–715.

CCDB · ipcn-api-dl — Sanjappa, M. 1979a. In IOPB chromosome number reports LXIV. Taxon 28: 393–395.

CCDB · ipcn-api-dl — Bir, S. S., B. S. Gill & Y. S. Bedi. 1979. In IOPB chromosome number reports LXIV. Taxon 28: 402–403.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type48 records

Wild obs. + sensor28

Museum / vouchered20

Range

Area of Occupancy AOO144 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 4≤1 km 7≤10 km 5

16 georeferenced · 12 without coordinates

Open the mapobservation + sensor28

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 3≤1 km 5

8 georeferenced · 12 without coordinates

Open the institutions mapphysical evidence20

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pondicherry, IN	5
Dehra Dun, IN	4
Baroda, IN	3
Honolulu, US	3
Bronx, US	2
BISHlocation not on record	2
Tampa, US	1

7 institutions · 20 of 20 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Gardenia latifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)