Gardenia erubescens

Stapf & Hutch. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Rubiaceae/Gardenia

At a glance

Occurrence records1 710

Data sources8

Biological traits20

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Gardenia erubescens's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 710 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources20 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF1 710 records

DNA & barcodingNCBIsequences

01Narrative

Gardenia erubescens is a shrub or small tree species with edible fruits that occurs in the Guinea and Sudan savannah vegetation of West and Central Africa. It is within the Rubiaceae family.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Plant height3 m

Plant height max3.05 m

Seed mass5.63 mg

Seed mass max5.63 mg

Seed mass min5.63 mg

Life cycle & reproduction5

Deciduousnessevergreen

Dehiscenceindehiscent

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit typeberry

Growth formshrub

Woodinesswoody

Physiology & chemistry2

Leaf n11.19 mg/g

Nitrogen fixingnon_nitrogen_fixer

Other traits1

Plant support typefree-standing

03Chemical composition1 compounds

Compounds documented for Gardenia erubescens across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Monosaccharides1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Mannitol		present	LOTUS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Gardenia erubescens has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

matKKJ815821.1 ↗1 728 bp

ACGT

GTGCGGCTAGCATCTTTTACACATTTAGATGAAGCAGAGGATTCATCTATACCATCGGTAAAGTTTGGAAGACCACGACTGATCCTGAAA …

Gardenia erubescens voucher Kristensen 51 (AAU) maturase K (matK) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

08Occurrence & distribution

Record type1 710 records

Wild obs. + sensor1 498

Museum / vouchered164

Other48

Range

Area of Occupancy AOO3 824 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 27≤1 km 6≤10 km 8>10 km 3

44 georeferenced · 1 454 without coordinates

Open the mapobservation + sensor1 498

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 11

11 georeferenced · 153 without coordinates

Open the institutions mapphysical evidence164

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Frankfurt am Main	22
Centre National de la Recherche Scientifique et Technologique / Institut de l'environnement et de recherches agricoleslocation not on record	17
Saint Louis, US	16
HNBlocation not on record	15
Xiamen, CN	10
CNF-UFHBlocation not on record	8
MeiseBGlocation not on record	8
Université du Lomélocation not on record	8
LSF/FSA/UAClocation not on record	4
Davis, US	3
Kew, GB	3
Herbier National du Gabonlocation not on record	2
Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record	2
LSFlocation not on record	2
Leiden University Medical Centerlocation not on record	2
UJLOGlocation not on record	1
Institut de Recherche Agronomique de Guinée (IRAG)location not on record	1
Institut Botanique Ake-Assi d'Andokoilocation not on record	1
Paris, FR	1
Plocation not on record	1
Centre National de Floristique - Université Félix HOUPHOUËT-BOIGNYlocation not on record	1
EFGlocation not on record	1
BRLUlocation not on record	1
Moscow State Universitylocation not on record	1
Berlin, DE	1

25 institutions · 132 of 164 vouchered records shown · 32 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Gardenia erubescens

At a glance

Sources8 archives

Size & morphology5

Life cycle & reproduction5

Diet & foraging1

Habitat & environment6

Physiology & chemistry2

Other traits1

Compound class profile1 class

Documented compounds1 total

At a glance

Record type1 710 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 25 geolocated

Record type1 710 records