Garcinia xanthochymus

Hook.fil. ex J.Anderson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Clusiaceae/Garcinia

At a glance

Occurrence records66

Data sources12

Biological traits38

DNA specimens9

eDNA detections7

Sources12 archives

Databases and archives Garcinia xanthochymus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility66 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources38 traits

Chemical compositionNPASS37 compounds

Occurrence & distributionGBIF66 records

Environmental DNA1 datasets · 0 countries7 detections

DNA & barcodingBOLD · NCBI9 specimens

Genome at a glanceGoaT · TreeOfSex2n = 72

01Narrative

Garcinia cambodgiensis là một loài thực vật có hoa trong họ Bứa. Loài này được Vesque mô tả khoa học đầu tiên năm 1889.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology15

Fruit length47.5 mm

Fruit width44 mm

Leaf length260 mm

Leaf length max340 mm

Leaf length min200 mm

Leaf width97.5 mm

⚠ sources differ — AusTraits: 97.5 mm · GIFT: 90 mm

Leaf width max120 mm

Leaf width min60 mm

Petiole length1.75 cm

Plant height12 m

⚠ sources differ — GIFT: 12 m · AusTraits: 7 m · TRY: 20 m

Plant height max20 m

Plant height min8 m

Seed mass4 450 mg

⚠ sources differ — TRY: 4 450 mg · GIFT: 5 509 mg

Seed mass max7 143 mg

Seed mass min3 875 mg

Life cycle & reproduction4

Deciduousnessevergreen

Life formtree

Life spanperennial

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment13

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max1 000 m

Elevation mean800 m

Elevation min300 m

Epiphyteterrestrial

Fruit typeberry

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: shrub tree · TRY: tree

Leaf compoundnesssimple

Leaf shapeelliptical oblong ovate

Mycorrhiza type0.000000375

Woodinesswoody

Physiology & chemistry5

Leaf n11.2 mg/g

Leaf p0.51 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density785 mg/cm³

⚠ sources differ — TRY: 785 mg/cm³ · GIFT: 955 mg/cm³

03Chemical composition37 compounds

Compounds documented for Garcinia xanthochymus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cooking

Compound class profile5 classes

Isoquinoline alkaloids17

Polyprenylated cyclic polyketides (Hop meroterpenoids)5

Plant xanthones4

Flavones2

Flavanones $ Flavones2

Documented compounds37 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Volkensiflavone	present	NPASS
(+/-)-Fukugiside	present	NPASS
(1'S,6S)-1-(dihydrochelerythrine-6-yl)ethanol	present	NPASS
(13R)-1,2,13-trimethoxy-12-methyl-13H-[1,3]benzodioxolo[5,6-c]phenanthridine	present	NPASS
(13R)-13-butoxy-1,2-dimethoxy-12-methyl-13H-[1,3]benzodioxolo[5,6-c]phenanthridine	present	NPASS
(13S)-13-[[(13R)-1,2-dimethoxy-12-methyl-13H-[1,3]benzodioxolo[5,6-c]phenanthridin-13-yl]oxy]-1,2-dimethoxy-12-methyl-13H-[1,3]benzodioxolo[5,6-c]phenanthridine	present	NPASS
(1R,3E,5S,7S)-3-((3,4-dihydroxyphenyl)-hydroxymethylidene)-6,6-dimethyl-5,7-bis(3-methylbut-2-enyl)-1-((2R)-5-methyl-2-prop-1-en-2-ylhex-5-enyl)bicyclo(3.3.1)nonane-2,4,9-trione	present	NPASS
(23S)-11,12-dimethoxy-24-methyl-5,7,18,20-tetraoxa-24-azahexacyclo[11.11.0.02,10.04,8.014,22.017,21]tetracosa-1(13),2,4(8),9,11,14(22),15,17(21)-octaen-23-ol	present	NPASS
(23S)-12-methoxy-24-methyl-5,7,18,20-tetraoxa-24-azahexacyclo[11.11.0.02,10.04,8.014,22.017,21]tetracosa-1(13),2,4(8),9,11,14(22),15,17(21)-octaen-23-ol	present	NPASS
(23S)-23-methoxy-24-methyl-5,7,18,20-tetraoxa-24-azahexacyclo[11.11.0.02,10.04,8.014,22.017,21]tetracosa-1(13),2,4(8),9,11,14(22),15,17(21)-octaene	present	NPASS

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Garcinia xanthochymus has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes2

GenBank sequences8

eDNA detections7

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMT160388.1 ↗785 bpIndia · 2013

ACGT

AAGTGTTCGGATTTGCGGCGACGTGGGCGGTTCGCCGCCGGCGACGTCGCAAGAAGTCCACTGAACCTTATCATTTAAAGGAAGGACAAG …

Garcinia xanthochymus voucher MH<IND>:177804 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL7★ITS1

plant barcodefungal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Garcinia xanthochymus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 72 n = 36

Ploidydiploid inferred

Chromosome records72–722n range72median72mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 722×GoaT · Tree of Sex Database · TreeOfSex · plant

GoaT · Tree of Sex Database — ↗

TreeOfSex · plant — Goldblatt1979 ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.885 ↗

08Occurrence & distribution

Record type66 records

Wild obs. + sensor26

Museum / vouchered36

Cultivated / captive3

Other1

Range

Area of Occupancy AOO180 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy64% within 1 km

≤100 m 8≤1 km 1≤10 km 1>10 km 4

14 georeferenced · 12 without coordinates

Open the mapobservation + sensor26

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 36 records without

Open the institutions mapphysical evidence36

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 2 without coordinates

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Southwest Forestry Collegelocation not on record	11
Guilin, CN	7
Yangling, CN	4
Beijing, CN	4
Taipei, TW	2
Honolulu, US	2
Jinghong, CN	1
Kunming, CN	1
Herbarium of South China Botanical Gardenlocation not on record	1
Miami, US	1
Gump Stationlocation not on record	1

11 institutions · 35 of 36 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA7 detections

Where the DNA of Garcinia xanthochymus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)