Garcinia talbotii

Raizada · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Clusiaceae/Garcinia

At a glance

Occurrence records241

Data sources11

Biological traits9

DNA specimens3

eDNA detections3

Sources11 archives

Databases and archives Garcinia talbotii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility241 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Chemical compositionLOTUS14 compounds

Occurrence & distributionGBIF241 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB · TreeOfSex2n = 72

01Narrative

گامبوجه نام یک گونه از سرده گارسینیا است.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formtree

Life spanperennial

Habitat & environment4

Climateseasonally dry tropical

Climberself-supporting

Growth formtree

Woodinesswoody

Physiology & chemistry2

Leaf dry-matter content (LDMC)324 mg/g

Wood density724 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition14 compounds

Compounds documented for Garcinia talbotii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Flavanones $ Flavones8

Flavanones2

Friedelane triterpenoids2

Stigmastane steroids1

Dihydroflavonols $ Flavanones1

Documented compounds14 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Morelloflavone	present	LOTUS
(2R,3R)-8-[(2S,3S)-5,7-dihydroxy-2-(4-hydroxyphenyl)-4-oxo-2,3-dihydrochromen-3-yl]-3,5,7-trihydroxy-2-(4-hydroxyphenyl)-2,3-dihydrochromen-4-one	present	LOTUS
(2S)-8-[(2R,3R)-5,7-dihydroxy-2-(4-hydroxyphenyl)-4-oxo-2,3-dihydrochromen-3-yl]-2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-2,3-dihydrochromen-4-one	present	LOTUS
(2S)-8-[(2R,3R)-5,7-dihydroxy-2-(4-hydroxyphenyl)-4-oxo-2,3-dihydrochromen-3-yl]-5,7-dihydroxy-2-(4-hydroxyphenyl)-2,3-dihydrochromen-4-one	present	LOTUS
8-[(2R,3R)-5,7-dihydroxy-2-(4-hydroxyphenyl)-4-oxo-2,3-dihydrochromen-3-yl]-5-hydroxy-2-(4-hydroxyphenyl)-7-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxychromen-4-one	present	LOTUS
8-[(2R,3S)-5,7-dihydroxy-2-(4-hydroxyphenyl)-4-oxo-2,3-dihydrochromen-3-yl]-5-hydroxy-2-(4-hydroxyphenyl)-7-[(2S,3S,4S,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxychromen-4-one	present	LOTUS
8-[(2S,3R)-5,7-dihydroxy-2-(4-hydroxyphenyl)-4-oxo-2,3-dihydrochromen-3-yl]-5-hydroxy-2-(4-hydroxyphenyl)-7-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxychromen-4-one	present	LOTUS
8-[(2S,3R)-5,7-Dihydroxy-2-(4-hydroxyphenyl)-4-oxo-chroman-3-YL]-5,7-dihydroxy-2-(4-hydroxyphenyl)chromen-4-one	present	LOTUS
beta-Sitosterol	present	LOTUS
Epifriedelanol	present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Garcinia talbotii has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences10

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPV464751.1 ↗633 bpIndia · 2025

ACGT

TGCCCAGCAGCACGACCCGTGAACTTGTTTACCACATTGACAAGTGCGTGTGGTCGGTCCTCGGATTGGCAACATGCCCTTGTAAGTCGA …

Garcinia talbotii isolate Blatter herbarium NI-2620 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★ITS7

plant barcodefungal barcode

06Genome at a glanceCCDB · TreeOfSex

The complete instruction manual Garcinia talbotii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 72 n = 36

Ploidydiploid inferred

Chromosome records72–722n range72median72mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 722×CCDB · ipcn-api-dl · TreeOfSex · plant

CCDB · ipcn-api-dl — Chennaveeraiah, M. S. & M. K. Razdan. 1980. Karyomorphological and phytochemical studies in evaluating species relationships in Garcinia Linn. and systematic position of G. xanthochymus complex. J. Indian Bot. Soc. 59: 251–262.

TreeOfSex · plant — Goldblatt1979 ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.889 ↗

08Occurrence & distribution

Record type241 records

Wild obs. + sensor186

Museum / vouchered55

Range

Area of Occupancy AOO268 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 160≤1 km 16≤10 km 5

181 georeferenced · 5 without coordinates

Open the mapobservation + sensor186

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 55 records without

Open the institutions mapphysical evidence55

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pondicherry, IN	50

1 institutions · 50 of 55 vouchered records shown · 4 without an institution code

09Environmental DNA3 detections

Where the DNA of Garcinia talbotii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median28.7 °C 28.7–28.7

Seasonal swing summer↔winter3.00 °C

Max temp (day)29.7 °C

Min temp (night)27.5 °C

Precipitation145 mm/mo

Air humidity62.1 %

Vapour deficit1,485 Pa

Cloud cover8.50 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)