Garcinia spicata

(Wight & Arn.) Hook.fil. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Clusiaceae/Garcinia

At a glance

Occurrence records60

Data sources8

Biological traits13

DNA specimens9

eDNA detections9

Sources8 archives

Databases and archives Garcinia spicata's data was compiled from.

GBIFGlobal Biodiversity Information Facility60 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources13 traits

Chemical compositionNPASS28 compounds

Occurrence & distributionGBIF60 records

Environmental DNA1 datasets · 1 countries9 detections

DNA & barcodingBOLD · NCBI9 specimens

Genome at a glanceGoaT2n = 72

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Leaf size7 733 mm²

Life cycle & reproduction3

Deciduousnessevergreen

Life formtree

Life spanperennial

Habitat & environment4

Climateseasonally dry tropical

Climberself-supporting

Growth formtree

Woodinesswoody

Physiology & chemistry4

Leaf C:N ratio44.68 g/g

Leaf dry-matter content (LDMC)494 mg/g

Leaf n16.5 mg/g

Specific leaf area (SLA)9.49 mm²/mg

Other traits1

Plant support typefree-standing

03Chemical composition28 compounds

Compounds documented for Garcinia spicata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Tetraketide meroterpenoids5

Spriromeroterpenoids3

Chromones1

Prenyl quinone meroterpenoids1

Documented compounds28 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,2S,4aR,4bS,7S,8aR,10aR)-3',7-dihydroxy-2,4b,8,8,10a-pentamethylspiro[2,3,4,4a,5,6,7,8a,9,10-decahydrophenanthrene-1,5'-furan]-2'-one	present	NPASS
(2S,2'S,4a'R,4b'S,7'S,8a'R,10a'R)-2',4b',7,8',8',10a'-hexamethyl-3',4',4a',4b',5',6',7',8',8a',9',10',10a'-dodecahydro-2'H,3H-spiro[benzofuran-2,1'-phenanthrene]-5,7'-diol	present	NPASS
(2S,4aR,4bR,6aS,12aS,12bR,14aR)-2,3,4,4a,4b,5,6,6a,12,12a,12b,13,14,14a-Tetradecahydro-1,1,4a,6a,8,12b-hexamethyl-1H-naphtho(2,1-a)xanthene-2,10-diol	present	NPASS
(2S,4aS,4bR,7S,8R,8aR,10aR)-1,1,4a,7,7',8a-hexamethylspiro[2,3,4,4b,5,6,7,9,10,10a-decahydrophenanthrene-8,2'-3H-1-benzofuran]-2,5'-diol	present	NPASS
2-(Geranylgeranyl)-6-methyl-1,4-benzoquinone	present	NPASS
2-Methyl-6-geranylgeranyl-1,4-benzoquinol	present	NPASS
3-[(1S,4aR,5S,6R,8aR)-5-[(5-acetyloxy-2-hydroxy-3-methylphenyl)methyl]-5,6,8a-trimethyl-2-propan-2-ylidene-3,4,4a,6,7,8-hexahydro-1H-naphthalen-1-yl]propanoic acid	present	NPASS
3-[(1S,4aR,5S,6S,8aR)-5,6,8a-trimethyl-5-[(5-methyl-3,6-dioxocyclohexa-1,4-dien-1-yl)methyl]-2-propan-2-ylidene-3,4,4a,6,7,8-hexahydro-1H-naphthalen-1-yl]propanoic acid	present	NPASS
3-[(1S,4aR,5S,6S,8aR)-5-[(2,5-dihydroxy-3-methylphenyl)methyl]-5,6,8a-trimethyl-2-oxo-3,4,4a,6,7,8-hexahydro-1H-naphthalen-1-yl]propanoic acid	present	NPASS
3-[(1S,4aR,5S,6S,8aR)-5-[(2,5-dihydroxy-3-methylphenyl)methyl]-5,6,8a-trimethyl-2-propan-2-ylidene-3,4,4a,6,7,8-hexahydro-1H-naphthalen-1-yl]propanoic acid	present	NPASS

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Garcinia spicata has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes4

GenBank sequences8

eDNA detections9

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMT160384.1 ↗568 bpIndia · 2018

ACGT

AACATGGCGGAGGACATTGTCGAAACCTGCCCAGCAGCACGACCTGTGAACTTGTTTACCACATTTACAAGTGCGTGTGGTCGGTCCTCG …

Garcinia spicata voucher MH<IND>:177823 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★ITS4★ITS2

plant barcodefungal barcode

06Genome at a glanceGoaT

The complete instruction manual Garcinia spicata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 72 n = 36

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 721×GoaT · Tree of Sex Database

GoaT · Tree of Sex Database — ↗

08Occurrence & distribution

Record type60 records

Wild obs. + sensor5

Museum / vouchered55

Range

Area of Occupancy AOO152 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 4 without coordinates

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 1>10 km 1

2 georeferenced · 53 without coordinates

Open the institutions mapphysical evidence55

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pondicherry, IN	25
Taipei, TW	15
Bronx, US	3
Sri Ramaswamy Memorial Universitylocation not on record	3
Baroda, IN	1
Saint Louis, US	1
University of Stellenboschlocation not on record	1
Miami, US	1
HAWlocation not on record	1
Monastir, TN	1

10 institutions · 52 of 55 vouchered records shown · 3 without an institution code

09Environmental DNA9 detections

Where the DNA of Garcinia spicata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 25.1–25.1

Seasonal swing summer↔winter16.5 °C

Max temp (day)30.5 °C

Min temp (night)19.3 °C

Precipitation109 mm/mo

Air humidity52.0 %

Moisture balance-17.8 mm/mo

Vapour deficit1,616 Pa

Wind speed1.80 m/s

Cloud cover25.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)