Garcinia pushpangadaniana

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Clusiaceae/Garcinia

At a glance

Occurrence records19

Data sources4

Biological traits2

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Garcinia pushpangadaniana's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility19 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF19 records

DNA & barcodingNCBIsequences

01Narrative

Garcinia pushpangadaniana is a tree species in the family Clusiaceae. It was described in 2013 from a population found in the southern part of the Western Ghats in India.Garcinia pushpangadaniana (Clusiaceae), a new species from the southern Western Ghats, India The specific epithet of this species honors Dr. P. Pushpangadan, former Director of Jawaharlal Nehru Tropical Botanical Garden & Research Institute.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVP

Life cycle & reproduction1

Life formtree

Habitat & environment1

Climatewet tropical

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Garcinia pushpangadaniana has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMW940710.1 ↗666 bpIndia · 2020

ACGT

AACCTGCCCAGCAGCACGACCCGTGAACTTGTTTACCACATTGACAAGTGCGTGTGGTCGGTCCTCGGATTGGCAACATGCCCTTGTAAG …

Garcinia pushpangadaniana isolate SR1741-GP internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

rbcL1ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type19 records

Wild obs. + sensor19

Range

Area of Occupancy AOO40 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 2≤1 km 12≤10 km 4

18 georeferenced · 1 without coordinates

Open the mapobservation + sensor19

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.