Garcinia pedunculata

Roxb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Clusiaceae/Garcinia

At a glance

Occurrence records31

Data sources10

Biological traits22

DNA specimens3

eDNA detections3

Sources10 archives

Databases and archives Garcinia pedunculata's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility31 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources22 traits

Chemical compositionLOTUS · NPASS14 compounds

Occurrence & distributionGBIF31 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Garcinia pedunculata, popularly known as Bor Thekera (বৰ ঠেকেৰা) in Assamese, is an evergreen tree related to the more familiar purple mangosteen (Garcinia mangostana). The tree is endemic to the south-eastern regions of Asia such as parts of Myanmar and north-eastern parts of India.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology8

Inflorescence length max15 cm

Inflorescence length min8 cm

Leaf length200 mm

Leaf length max250 mm

Leaf length min150 mm

Leaf width max120 mm

Leaf width min70 mm

Plant height20 m

Life cycle & reproduction2

Life formtree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max350 m

Elevation mean300 m

Elevation min250 m

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

Other traits1

Plant support typefree-standing

03Chemical composition14 compounds

Compounds documented for Garcinia pedunculata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Guaiane sesquiterpenoids7

Polyprenylated cyclic polyketides (Hop meroterpenoids)5

Acyl phloroglucinols1

Documented compounds14 total

Tissue Source Quantified only

Compound	Amount	Source
(1S,3S,9S,11R)-7-(3,4-dihydroxybenzoyl)-4,4,10,10-tetramethyl-3,9,11-tris(3-methylbut-2-enyl)-5-oxatricyclo[7.3.1.01,6]tridec-6-ene-8,13-dione	present	LOTUS
(1S,3Z,5R,7R)-3-[(3,4-dihydroxyphenyl)-hydroxy-methylene]-1-[(2S)-2-isopropenyl-5-methyl-hex-4-enyl]-6,6-dimethyl-5,7-bis(3-methylbut-2-enyl)bicyclo[3.3.1]nonane-2,4,9-trione	present	LOTUS
(3aR,4S,6aR,8S,9aR,9bR)-8-hydroxy-3,6,9-trimethylidene-4-(2-methylpropoxy)-3a,4,5,6a,7,8,9a,9b-octahydroazuleno[4,5-b]furan-2-one	present	NPASS
(3S,3aR,4S,6aR,8R,9R,9aS,9bS)-4,8,9-trihydroxy-9-(hydroxymethyl)-3-methyl-6-methylidene-3a,4,5,6a,7,8,9a,9b-octahydro-3H-azuleno[4,5-b]furan-2-one	present	NPASS
(3S,3aR,4S,6aR,8S,9aR,9bR)-8-hydroxy-3-methyl-6,9-dimethylidene-4-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3a,4,5,6a,7,8,9a,9b-octahydro-3H-azuleno[4,5-b]furan-2-one	present	NPASS
(3S,3aR,4S,6aR,9S,9aR,9bR)-Octahydro-4-hydroxy-3,9-dimethyl-6-methyleneazuleno(4,5-b)furan-2,8(3H,4H)-dione	present	NPASS
2,4,6,3',5'-Pentahydroxybenzophenone	present	LOTUS
[(3S,3aR,4S,6aR,9S,9aR,9bR)-3,9-dimethyl-6-methylidene-2,8-dioxo-3a,4,5,6a,7,9,9a,9b-octahydro-3H-azuleno[4,5-b]furan-4-yl] acetate	present	NPASS
Aguerin B	present	NPASS
Cynaropicrin	present	NPASS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Garcinia pedunculata has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences9

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMF990623.1 ↗278 bpIndia · 2015

ACGT

TAGCACATGGTTCCTCAAGACGCAACAAACCAATCTCGGCGCGGGATGCGCCAAGGAACTATTGTAAATGCAAAAGGAACTCCTCTCCAT …

Garcinia pedunculata isolate DU101 internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL4★ITS5

plant barcodefungal barcode

08Occurrence & distribution

Record type31 records

Wild obs. + sensor2

Museum / vouchered29

Range

Area of Occupancy AOO40 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 1 without coordinates

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence29

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kunming, CN	10
Southwest Forestry Collegelocation not on record	7
Beijing, CN	7
Xining, CN	2
Columbia, US	1
Sri Ramaswamy Memorial Universitylocation not on record	1
LDlocation not on record	1

7 institutions · 29 of 29 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Garcinia pedunculata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 25.1–25.1

Seasonal swing summer↔winter16.5 °C

Max temp (day)30.5 °C

Min temp (night)19.3 °C

Precipitation109 mm/mo

Air humidity52.0 %

Moisture balance-17.8 mm/mo

Vapour deficit1,616 Pa

Wind speed1.80 m/s

Cloud cover25.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)