Garcinia nigrolineata

Planch. ex T.Anderson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Clusiaceae/Garcinia

At a glance

Occurrence records54

Data sources10

Biological traits12

DNA specimens2

eDNA detections2

Sources10 archives

Databases and archives Garcinia nigrolineata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility54 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Chemical compositionLOTUS · NPASS63 compounds

Occurrence & distributionGBIF54 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Garcinia nigrolineata has been called "wild beaked Kandis" (from the Malay name – see below) and is a tree species in the family Clusiaceae. The Catalogue of Life lists no subspecies.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction3

Deciduousnessevergreen

Life formtree

Life spanperennial

Habitat & environment5

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density600 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition63 compounds

Compounds documented for Garcinia nigrolineata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Plant xanthones63

Germacrane sesquiterpenoids6

Methyl xanthones $ Plant xanthones4

Prenyl quinone meroterpenoids4

Friedelane triterpenoids2

Documented compounds63 total

Tissue Source Quantified only

Compound	Amount	Source
(3aR,4R,6E,10Z,11aR)-6-methyl-4-[(E)-2-methylbut-2-enoyl]oxy-3-methylidene-2-oxo-3a,4,5,8,9,11a-hexahydrocyclodeca[b]furan-10-carboxylic acid	present	NPASS
(3aR,4R,6E,10Z,11aR)-6-methyl-4-[(Z)-2-methylbut-2-enoyl]oxy-3-methylidene-2-oxo-3a,4,5,8,9,11a-hexahydrocyclodeca[b]furan-10-carboxylic acid	present	NPASS
(3S)-3-[(3E)-4,8-dimethylnona-3,7-dienyl]-6,11-dihydroxy-3-methylpyrano[2,3-c]xanthen-7-one	present	LOTUS
1,3,5,8-Tetrahydroxy-4-(3-hydroxy-3-methylbutyl)xanthen-9-one	present	LOTUS
1,3,5-Trihydroxy-4-(3-hydroxy-3-methylbutyl)xanthone	present	LOTUS
1,3,7-Trihydroxy-2-(3-hydroxy-3-methylbutyl)xanthen-9-one	present	LOTUS
1,5,6-Trihydroxy-3-methoxy-4-(3-hydroxyl-3-methylbutyl)xanthone	present	LOTUS
1,5-Dihydroxy-3-methoxy-2-prenylxanthone	present	LOTUS
1,7-Dihydroxy-3-methoxy-2-(3-methyl-2-buten-1-yl)-9H-xanthen-9-one	present	LOTUS
10,15-Dihydroxy-7,7,19,19-tetramethyl-2,8,20-trioxapentacyclo[12.8.0.03,12.04,9.016,21]docosa-1(22),3,5,9,11,14,16(21),17-octaen-13-one	present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Garcinia nigrolineata has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences3

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSAF367216.1 ↗621 bp

ACGT

TCGAAACTCGCCAAATAGCACGACTCGTGAACTCGTTTACACATCGACAGAGGTGTGTGGTCAGTCATTGGATTGGCAACATACCTTGTA …

Garcinia nigrolineata internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS3★ITS2

fungal barcode

08Occurrence & distribution

Record type54 records

Wild obs. + sensor10

Museum / vouchered44

Range

Area of Occupancy AOO76 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 9

9 georeferenced · 1 without coordinates

Open the mapobservation + sensor10

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 43 without coordinates

Open the institutions mapphysical evidence44

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Xiamen, CN	12
Kew, GB	7
Monastir, TN	3
Moscow State Universitylocation not on record	2

4 institutions · 24 of 44 vouchered records shown · 20 without an institution code

09Environmental DNA2 detections

Where the DNA of Garcinia nigrolineata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)