Garcinia multiflora

Champ. ex Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Clusiaceae/Garcinia

At a glance

Occurrence records875

Data sources11

Biological traits40

DNA specimens5

eDNA detections3

Sources11 archives

Databases and archives Garcinia multiflora's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility875 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources40 traits

Chemical compositionLOTUS · NPASS143 compounds

Occurrence & distributionGBIF875 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

Garcinia multiflora is a tree species in the family Clusiaceae. No subspecies are listed in the Catalogue of Life. It is called dọc in Vietnamese and used to flavour and colour bún riêu soup.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology18

Fruit length40 mm

Fruit length max50 mm

Fruit length min30 mm

Inflorescence length max7.0 cm

Inflorescence length min5 cm

Leaf length115 mm

Leaf length max160 mm

Leaf length min70 mm

Leaf size2 319 mm²

Leaf width45 mm

Leaf width max60 mm

Leaf width min30 mm

Plant height10 m

⚠ sources differ — GIFT: 10 m · TRY: 12 m

Plant height max15 m

Plant height min5 m

Seed mass1 472 mg

Seed mass max1 472 mg

Seed mass min1 472 mg

Life cycle & reproduction4

Deciduousnessevergreen

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 900 m

Elevation mean1 000 m

Elevation min100 m

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry7

Leaf dry-matter content (LDMC)284 mg/g

Leaf n10.9 mg/g

Leaf p0.422 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)10.48 mm²/mg

Wood density643 mg/cm³

⚠ sources differ — TRY: 643 mg/cm³ · GIFT: 858 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition143 compounds

Compounds documented for Garcinia multiflora across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cooking

Compound class profile5 classes

Polyprenylated cyclic polyketides (Hop meroterpenoids)34

Caryophyllane sesquiterpenoids29

Flavanones20

Flavanones $ Flavones15

Acyl phloroglucinols8

Documented compounds143 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Isoxanthochymol	present	LOTUS
(+)-Morelloflavone	present	LOTUS
(+)-Volkensiflavone	present	LOTUS
(+/-)-Fukugiside	present	NPASS
(1R)-1-[(2E)-3,7-dimethylocta-2,6-dienyl]-3,6,8-trihydroxy-1-(3-methylbut-2-enyl)xanthene-2,9-dione	present	LOTUS
(1R,3R,4R,6R,17S,19S)-4,6,11,12-tetrahydroxy-4,18,18-trimethyl-3,17,19-tris(3-methylbut-2-enyl)-15-oxapentacyclo[15.3.1.01,6.07,16.09,14]henicosa-7(16),9,11,13-tetraene-8,21-dione	present	LOTUS
(1R,3R,4R,6R,8R)-3-benzoyl-8-[(2R)-2,3-dihydroxy-3-methylbutyl]-4-(2-hydroxypropan-2-yl)-7,7-dimethyl-1-[(2S)-5-methyl-2-prop-1-en-2-ylhex-4-enyl]tricyclo[4.3.1.13,8]undecane-2,9,11-trione	present	LOTUS
(1R,3R,4R,6R,8S)-3-benzoyl-8-(2,3-dihydroxy-3-methylbutyl)-4-(2-hydroxypropan-2-yl)-7,7-dimethyl-1-[(2S)-5-methyl-2-prop-1-en-2-ylhex-4-enyl]tricyclo[4.3.1.13,8]undecane-2,9,11-trione	present	LOTUS
(1R,3S,9R,11R)-7-benzoyl-4,4,10,10-tetramethyl-3,9,11-tris(3-methylbut-2-enyl)-5-oxatricyclo[7.3.1.01,6]tridec-6-ene-8,13-dione	present	LOTUS
(1R,4R,9R)-4-(hydroxymethyl)-11,11-dimethyl-8-methylidenebicyclo[7.2.0]undecan-3-one	present	NPASS

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Garcinia multiflora has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes3

GenBank sequences10

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN704724.1 ↗585 bp

ACGT

GGGCATCTGGAGAGGTCCTCGGGGCCCAACCTCCCACCCGTGTATACCGTACCTTGTTGCTTCGGCGGGCCCGCCGCGCAAGCGGCCGCC …

UNVERIFIED_ORG: Garcinia multiflora strain N36-1-2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL3★ITS5

plant barcodefungal barcode

08Occurrence & distribution

Record type875 records

Wild obs. + sensor20

Museum / vouchered855

Range

Area of Occupancy AOO1 064 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy42% within 1 km

≤100 m 4≤1 km 1≤10 km 5>10 km 2

12 georeferenced · 8 without coordinates

Open the mapobservation + sensor20

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 854 without coordinates

Open the institutions mapphysical evidence855

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 41 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Guangzhou, CN	195
Beijing, CN	145
Guilin, CN	135
Kunming, CN	79
Chengdu, CN	41
Taipei, TW	30
Guangzhou, CN	29
Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record	24
FJFClocation not on record	21
Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record	21
Xiamen, CN	19
Yangling, CN	14
Shanghai, CN	10
Zhuzhou, CN	10
Hangzhou, CN	10
Wuhan, CN	9
Central China Normal Universitylocation not on record	7
South China Normal Universitylocation not on record	6
Bronx, US	6
Nanjing, CN	5
Fujian Institute of Subtropical Botanylocation not on record	4
Guangxi Agricultural Universitylocation not on record	4
Saint Louis, US	3
Jiangxi College of Traditional Chinese Medicinelocation not on record	3
Southwest Forestry Collegelocation not on record	2
Nagasaki University - Fisherieslocation not on record	2
Zhejiang Universitylocation not on record	2
Seoul, KR	2
Nanjing, CN	2
Servico de Microbiologia e Imunologialocation not on record	1
Vietnam Academy of Science and Technology (VAST)location not on record	1
SCAUlocation not on record	1
CASlocation not on record	1
Jiujiang Forestry Institutelocation not on record	1
Cincinnati, US	1
Edinburgh, GB	1
Tianjin Natural History Museumlocation not on record	1
Monastir, TN	1
Guizhou Forestry Schoollocation not on record	1
Wuhan, CN	1
University of Stellenboschlocation not on record	1

41 institutions · 852 of 855 vouchered records shown · 3 without an institution code

09Environmental DNA3 detections

Where the DNA of Garcinia multiflora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.7 °C 22.7–22.7

Seasonal swing summer↔winter15.4 °C

Max temp (day)25.7 °C

Min temp (night)18.7 °C

Precipitation157 mm/mo

Air humidity63.0 %

Moisture balance48.2 mm/mo

Vapour deficit1,036 Pa

Wind speed2.40 m/s

Cloud cover48.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)